Incidental Mutation 'R5554:Pet100'
ID435290
Institutional Source Beutler Lab
Gene Symbol Pet100
Ensembl Gene ENSMUSG00000087687
Gene NamePET100 homolog
Synonyms
MMRRC Submission 043111-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R5554 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3621548-3625848 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3622381 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 19 (I19F)
Ref Sequence ENSEMBL: ENSMUSP00000146950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004749] [ENSMUST00000019614] [ENSMUST00000128566] [ENSMUST00000133459] [ENSMUST00000136105] [ENSMUST00000142431] [ENSMUST00000144977] [ENSMUST00000156380] [ENSMUST00000159235] [ENSMUST00000207389] [ENSMUST00000207428] [ENSMUST00000208950]
Predicted Effect probably benign
Transcript: ENSMUST00000004749
SMART Domains Protein: ENSMUSP00000004749
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 26 48 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019614
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128566
Predicted Effect probably benign
Transcript: ENSMUST00000133459
SMART Domains Protein: ENSMUSP00000122902
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 7 29 3.29e-6 SMART
GoLoco 47 69 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136105
SMART Domains Protein: ENSMUSP00000121079
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 23 45 3.29e-6 SMART
GoLoco 63 85 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142431
SMART Domains Protein: ENSMUSP00000121403
Gene: ENSMUSG00000004630

DomainStartEndE-ValueType
GoLoco 26 48 4.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145855
Predicted Effect possibly damaging
Transcript: ENSMUST00000156380
AA Change: I23F

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137626
Gene: ENSMUSG00000087687
AA Change: I23F

DomainStartEndE-ValueType
Pfam:DUF2346 1 72 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159235
SMART Domains Protein: ENSMUSP00000124237
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 12 47 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159548
SMART Domains Protein: ENSMUSP00000124202
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 10 44 4e-12 BLAST
HAT 46 78 7.56e0 SMART
HAT 91 120 1.92e2 SMART
HAT 122 156 4.89e-2 SMART
Blast:HAT 157 190 4e-12 BLAST
Pfam:TPR_2 243 272 2.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207257
Predicted Effect probably damaging
Transcript: ENSMUST00000207389
AA Change: I14F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000207428
AA Change: I19F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208185
Predicted Effect possibly damaging
Transcript: ENSMUST00000208950
AA Change: I23F

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial complex IV, or cytochrome c oxidase, is a large transmembrane protein complex that is part of the respiratory electron transport chain of mitochondria. The small protein encoded by this gene plays a role in the biogenesis of mitochondrial complex IV. This protein localizes to the inner mitochondrial membrane and is exposed to the intermembrane space. Mutations in this gene are associated with mitochondrial complex IV deficiency. This gene has a pseudogene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Btn1a1 A T 13: 23,459,125 F385I possibly damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Evi5l A G 8: 4,206,491 probably benign Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fiz1 T C 7: 5,012,850 H47R probably damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Nbr1 C T 11: 101,564,807 T129I probably benign Het
Olfr178 A T 16: 58,889,806 M138K possibly damaging Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Patj T A 4: 98,454,396 S576T possibly damaging Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
Ptpn3 G T 4: 57,240,843 N257K probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Ugt3a2 A G 15: 9,370,201 Q477R probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Pet100
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2143:Pet100 UTSW 8 3622355 missense probably damaging 1.00
R2144:Pet100 UTSW 8 3622355 missense probably damaging 1.00
R6120:Pet100 UTSW 8 3621764 intron probably null
R6377:Pet100 UTSW 8 3622370 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGCTTGATCATGAAAACCAGG -3'
(R):5'- CTGTGGAACAAAGTCACAGGTG -3'

Sequencing Primer
(F):5'- TCATGAAAACCAGGCTTTAAGGTGC -3'
(R):5'- CAAAGTCACAGGTGAGAACAC -3'
Posted On2016-10-24