Incidental Mutation 'R5554:Evi5l'
ID435291
Institutional Source Beutler Lab
Gene Symbol Evi5l
Ensembl Gene ENSMUSG00000011832
Gene Nameecotropic viral integration site 5 like
Synonyms
MMRRC Submission 043111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5554 (G1)
Quality Score120
Status Validated
Chromosome8
Chromosomal Location4166567-4211257 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 4206491 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168386] [ENSMUST00000176072] [ENSMUST00000176149] [ENSMUST00000176764] [ENSMUST00000176825]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148353
Predicted Effect probably benign
Transcript: ENSMUST00000168386
SMART Domains Protein: ENSMUSP00000133114
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.9e-10 PROSPERO
internal_repeat_1 87 106 5.9e-10 PROSPERO
low complexity region 109 123 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
low complexity region 390 425 N/A INTRINSIC
low complexity region 466 497 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 571 612 N/A INTRINSIC
low complexity region 647 726 N/A INTRINSIC
low complexity region 733 751 N/A INTRINSIC
low complexity region 755 780 N/A INTRINSIC
low complexity region 783 867 N/A INTRINSIC
low complexity region 1020 1045 N/A INTRINSIC
Pfam:DUF4596 1053 1098 4.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175650
Predicted Effect probably benign
Transcript: ENSMUST00000176072
SMART Domains Protein: ENSMUSP00000134867
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 415 451 4.14e-7 PROSPERO
coiled coil region 455 478 N/A INTRINSIC
internal_repeat_1 513 549 4.14e-7 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176149
SMART Domains Protein: ENSMUSP00000135479
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 463 509 1.56e-7 PROSPERO
coiled coil region 513 536 N/A INTRINSIC
internal_repeat_1 563 607 1.56e-7 PROSPERO
low complexity region 755 766 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176462
Predicted Effect probably benign
Transcript: ENSMUST00000176645
Predicted Effect probably benign
Transcript: ENSMUST00000176764
SMART Domains Protein: ENSMUSP00000134857
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 4e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
coiled coil region 363 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176825
SMART Domains Protein: ENSMUSP00000135700
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 452 498 1.86e-7 PROSPERO
coiled coil region 502 525 N/A INTRINSIC
internal_repeat_1 552 596 1.86e-7 PROSPERO
low complexity region 744 755 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177455
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Btn1a1 A T 13: 23,459,125 F385I possibly damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fiz1 T C 7: 5,012,850 H47R probably damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Nbr1 C T 11: 101,564,807 T129I probably benign Het
Olfr178 A T 16: 58,889,806 M138K possibly damaging Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Patj T A 4: 98,454,396 S576T possibly damaging Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pet100 A T 8: 3,622,381 I19F probably damaging Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
Ptpn3 G T 4: 57,240,843 N257K probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Ugt3a2 A G 15: 9,370,201 Q477R probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Evi5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Evi5l APN 8 4193219 critical splice donor site probably null
IGL02143:Evi5l APN 8 4191293 missense probably damaging 0.99
IGL02322:Evi5l APN 8 4187236 splice site probably benign
IGL02528:Evi5l APN 8 4193172 missense probably benign 0.25
IGL02822:Evi5l APN 8 4187248 missense probably damaging 1.00
R0280:Evi5l UTSW 8 4193133 missense probably damaging 1.00
R1764:Evi5l UTSW 8 4203560 missense probably damaging 0.98
R2032:Evi5l UTSW 8 4210622 missense probably damaging 1.00
R2158:Evi5l UTSW 8 4193195 missense probably damaging 0.99
R2175:Evi5l UTSW 8 4187269 missense probably damaging 1.00
R2357:Evi5l UTSW 8 4193113 splice site probably benign
R3055:Evi5l UTSW 8 4191603 nonsense probably null
R3724:Evi5l UTSW 8 4178080 intron probably benign
R3956:Evi5l UTSW 8 4191358 missense possibly damaging 0.72
R4342:Evi5l UTSW 8 4183492 utr 5 prime probably benign
R4621:Evi5l UTSW 8 4202909 intron probably benign
R4622:Evi5l UTSW 8 4202909 intron probably benign
R4959:Evi5l UTSW 8 4205406 missense probably benign 0.00
R4973:Evi5l UTSW 8 4205406 missense probably benign 0.00
R5052:Evi5l UTSW 8 4206019 intron probably benign
R5097:Evi5l UTSW 8 4193317 missense probably damaging 0.97
R5344:Evi5l UTSW 8 4185990 missense possibly damaging 0.78
R5357:Evi5l UTSW 8 4203623 missense possibly damaging 0.63
R5376:Evi5l UTSW 8 4210770 missense probably damaging 0.99
R5382:Evi5l UTSW 8 4178653 intron probably benign
R5500:Evi5l UTSW 8 4191658 missense probably damaging 0.96
R5689:Evi5l UTSW 8 4205460 nonsense probably null
R5788:Evi5l UTSW 8 4206800 utr 3 prime probably benign
R6321:Evi5l UTSW 8 4203080 missense probably benign
R6520:Evi5l UTSW 8 4205906 missense possibly damaging 0.76
R6620:Evi5l UTSW 8 4206674 missense possibly damaging 0.84
R6707:Evi5l UTSW 8 4206322 missense probably benign
R7232:Evi5l UTSW 8 4205906 missense possibly damaging 0.71
R7692:Evi5l UTSW 8 4200886 missense probably damaging 1.00
X0062:Evi5l UTSW 8 4191303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAAGACTGAGGTGAGAGC -3'
(R):5'- TCATCTGCATCGCTGTCTGAG -3'

Sequencing Primer
(F):5'- CAAAGGATATCGGGCACAGGC -3'
(R):5'- TTCTGAAGAAGCGCGCGTC -3'
Posted On2016-10-24