Incidental Mutation 'R5554:Ugt3a2'
ID435313
Institutional Source Beutler Lab
Gene Symbol Ugt3a2
Ensembl Gene ENSMUSG00000049152
Gene NameUDP glycosyltransferases 3 family, polypeptide A2
Synonyms
MMRRC Submission 043111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5554 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9335550-9370955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9370201 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 477 (Q477R)
Ref Sequence ENSEMBL: ENSMUSP00000072236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072403]
Predicted Effect probably damaging
Transcript: ENSMUST00000072403
AA Change: Q477R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072236
Gene: ENSMUSG00000049152
AA Change: Q477R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.1e-99 PFAM
Pfam:Glyco_tran_28_C 307 450 1.5e-11 PFAM
Meta Mutation Damage Score 0.2087 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Btn1a1 A T 13: 23,459,125 F385I possibly damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Evi5l A G 8: 4,206,491 probably benign Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fiz1 T C 7: 5,012,850 H47R probably damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Nbr1 C T 11: 101,564,807 T129I probably benign Het
Olfr178 A T 16: 58,889,806 M138K possibly damaging Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Patj T A 4: 98,454,396 S576T possibly damaging Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pet100 A T 8: 3,622,381 I19F probably damaging Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
Ptpn3 G T 4: 57,240,843 N257K probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Ugt3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ugt3a2 APN 15 9367268 missense probably damaging 0.99
IGL01131:Ugt3a2 APN 15 9365162 missense probably damaging 1.00
IGL01627:Ugt3a2 APN 15 9335720 missense probably damaging 1.00
IGL01746:Ugt3a2 APN 15 9361668 missense probably damaging 1.00
IGL01949:Ugt3a2 APN 15 9335729 missense probably damaging 1.00
IGL02213:Ugt3a2 APN 15 9370224 missense probably benign 0.00
IGL02407:Ugt3a2 APN 15 9365230 nonsense probably null
IGL02588:Ugt3a2 APN 15 9361456 missense probably benign
IGL02894:Ugt3a2 APN 15 9367401 missense probably damaging 1.00
IGL02966:Ugt3a2 APN 15 9370068 missense probably damaging 1.00
IGL03385:Ugt3a2 APN 15 9338738 missense probably damaging 0.99
IGL03493:Ugt3a2 APN 15 9361483 missense probably damaging 0.96
R0554:Ugt3a2 UTSW 15 9351120 missense probably benign 0.14
R0833:Ugt3a2 UTSW 15 9370150 missense probably damaging 0.96
R1071:Ugt3a2 UTSW 15 9367368 missense possibly damaging 0.82
R1513:Ugt3a2 UTSW 15 9361524 missense probably benign 0.07
R1844:Ugt3a2 UTSW 15 9351168 missense probably benign 0.07
R1874:Ugt3a2 UTSW 15 9365351 missense probably damaging 1.00
R2305:Ugt3a2 UTSW 15 9351117 missense probably benign
R3052:Ugt3a2 UTSW 15 9365288 missense probably damaging 1.00
R3755:Ugt3a2 UTSW 15 9367412 missense probably benign 0.21
R3945:Ugt3a2 UTSW 15 9370098 missense possibly damaging 0.91
R4135:Ugt3a2 UTSW 15 9338724 missense probably damaging 0.98
R4261:Ugt3a2 UTSW 15 9335793 splice site probably null
R4438:Ugt3a2 UTSW 15 9351197 missense probably benign 0.01
R4570:Ugt3a2 UTSW 15 9338721 missense probably benign 0.12
R4791:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R4957:Ugt3a2 UTSW 15 9365188 missense probably benign 0.27
R5011:Ugt3a2 UTSW 15 9365287 missense probably damaging 1.00
R5035:Ugt3a2 UTSW 15 9361618 missense probably benign 0.01
R5573:Ugt3a2 UTSW 15 9361683 missense probably damaging 1.00
R5631:Ugt3a2 UTSW 15 9361885 missense probably damaging 0.98
R5696:Ugt3a2 UTSW 15 9361448 splice site silent
R6265:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R6302:Ugt3a2 UTSW 15 9365311 missense probably damaging 1.00
R6311:Ugt3a2 UTSW 15 9361518 nonsense probably null
R6680:Ugt3a2 UTSW 15 9370068 missense probably damaging 1.00
Z1177:Ugt3a2 UTSW 15 9367257 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAAATAGGTAACAGCCTTTCTC -3'
(R):5'- ACTCGGGTGCATCAGTAGAAG -3'

Sequencing Primer
(F):5'- CTGTCTATGTCTACAGGTACAAGTC -3'
(R):5'- TGCTGAATTACGGAAGGCCTC -3'
Posted On2016-10-24