Incidental Mutation 'R5555:Ptprf'
ID435326
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Nameprotein tyrosine phosphatase, receptor type, F
SynonymsRPTP-LAR, LAR
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R5555 (G1)
Quality Score205
Status Not validated
Chromosome4
Chromosomal Location118208213-118291405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118224924 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1039 (Y1039C)
Ref Sequence ENSEMBL: ENSMUSP00000039368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074]
PDB Structure
Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049074
AA Change: Y1039C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: Y1039C

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124758
AA Change: Y461C
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: Y461C

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143348
Predicted Effect unknown
Transcript: ENSMUST00000150096
AA Change: Y420C
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: Y420C

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118223220 splice site probably benign
IGL01337:Ptprf APN 4 118236291 missense probably damaging 1.00
IGL01482:Ptprf APN 4 118212454 missense probably damaging 1.00
IGL01743:Ptprf APN 4 118248898 critical splice donor site probably null
IGL01987:Ptprf APN 4 118277370 missense probably benign
IGL02189:Ptprf APN 4 118213642 splice site probably benign
IGL03067:Ptprf APN 4 118210713 missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118213612 missense probably damaging 1.00
R0382:Ptprf UTSW 4 118223394 splice site probably benign
R0788:Ptprf UTSW 4 118226466 missense probably damaging 0.97
R1164:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R1478:Ptprf UTSW 4 118212105 nonsense probably null
R1483:Ptprf UTSW 4 118235964 missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118236233 missense probably benign 0.34
R1721:Ptprf UTSW 4 118224899 missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118223265 missense probably benign 0.02
R1818:Ptprf UTSW 4 118209871 missense probably damaging 1.00
R1860:Ptprf UTSW 4 118223932 missense probably damaging 1.00
R2208:Ptprf UTSW 4 118269172 splice site probably benign
R2406:Ptprf UTSW 4 118269304 missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118248980 missense probably damaging 0.98
R3111:Ptprf UTSW 4 118211432 missense probably damaging 1.00
R3498:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3499:Ptprf UTSW 4 118224930 missense probably damaging 0.99
R3615:Ptprf UTSW 4 118237883 missense probably benign 0.04
R3616:Ptprf UTSW 4 118237883 missense probably benign 0.04
R4038:Ptprf UTSW 4 118257608 missense probably damaging 1.00
R4243:Ptprf UTSW 4 118226452 critical splice donor site probably null
R4260:Ptprf UTSW 4 118226083 missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118211022 missense probably benign 0.16
R4726:Ptprf UTSW 4 118212217 missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118225039 missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118210329 intron probably benign
R4857:Ptprf UTSW 4 118217197 splice site probably benign
R5071:Ptprf UTSW 4 118211999 missense probably damaging 1.00
R5221:Ptprf UTSW 4 118225108 missense probably benign 0.00
R5327:Ptprf UTSW 4 118236389 missense probably damaging 1.00
R5336:Ptprf UTSW 4 118235634 missense probably damaging 1.00
R5356:Ptprf UTSW 4 118226338 missense probably benign 0.00
R5373:Ptprf UTSW 4 118226041 missense possibly damaging 0.93
R5693:Ptprf UTSW 4 118236177 nonsense probably null
R5860:Ptprf UTSW 4 118211289 intron probably benign
R5869:Ptprf UTSW 4 118210382 missense probably damaging 1.00
R5890:Ptprf UTSW 4 118224735 missense probably benign
R5932:Ptprf UTSW 4 118211767 missense probably benign 0.10
R6028:Ptprf UTSW 4 118213629 missense probably benign 0.01
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6030:Ptprf UTSW 4 118211048 missense probably benign 0.19
R6088:Ptprf UTSW 4 118210755 missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118211084 missense probably damaging 0.99
R6108:Ptprf UTSW 4 118223256 missense probably benign 0.01
R6320:Ptprf UTSW 4 118212814 missense probably benign
R6741:Ptprf UTSW 4 118223368 missense probably benign 0.00
R6744:Ptprf UTSW 4 118236365 missense probably benign 0.00
R6750:Ptprf UTSW 4 118231731 missense probably benign 0.03
R6906:Ptprf UTSW 4 118269277 missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118223904 missense probably benign 0.00
R7153:Ptprf UTSW 4 118231543 missense probably damaging 1.00
R7326:Ptprf UTSW 4 118231669 missense probably damaging 0.99
R7337:Ptprf UTSW 4 118211125 missense probably damaging 0.99
R7374:Ptprf UTSW 4 118257492 missense probably damaging 1.00
R7375:Ptprf UTSW 4 118212814 missense probably benign
R7399:Ptprf UTSW 4 118226523 missense probably benign 0.28
R7417:Ptprf UTSW 4 118212172 missense probably damaging 1.00
R7448:Ptprf UTSW 4 118235667 missense probably benign 0.03
R7530:Ptprf UTSW 4 118212748 missense probably damaging 1.00
R7593:Ptprf UTSW 4 118212396 missense probably benign 0.00
X0067:Ptprf UTSW 4 118236026 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGCGGCCATCCTCTATAAAGG -3'
(R):5'- CCAAGAATTTCCGTGTGGC -3'

Sequencing Primer
(F):5'- CCATCCTCTATAAAGGCGGAGG -3'
(R):5'- CCGCTGCGATGAAGACATC -3'
Posted On2016-10-24