Incidental Mutation 'R5555:Stk40'
ID435327
Institutional Source Beutler Lab
Gene Symbol Stk40
Ensembl Gene ENSMUSG00000042608
Gene Nameserine/threonine kinase 40
Synonyms
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126103957-126141029 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126135059 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 238 (V238E)
Ref Sequence ENSEMBL: ENSMUSP00000111990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094761] [ENSMUST00000116286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094761
AA Change: V224E

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092354
Gene: ENSMUSG00000042608
AA Change: V224E

DomainStartEndE-ValueType
Pfam:Pkinase 36 328 5.6e-39 PFAM
Pfam:Pkinase_Tyr 36 328 2.4e-20 PFAM
Pfam:Kinase-like 116 318 2e-8 PFAM
low complexity region 350 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116286
AA Change: V238E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111990
Gene: ENSMUSG00000042608
AA Change: V238E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 51 342 1.9e-19 PFAM
Pfam:Pkinase 52 342 9.2e-37 PFAM
Pfam:Kinase-like 130 332 1.7e-8 PFAM
low complexity region 364 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134369
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality associated with cyanosis, atelectasis, respiratory distress and impaired lung maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Stk40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Stk40 APN 4 126136902 missense probably damaging 1.00
IGL03081:Stk40 APN 4 126123714 critical splice acceptor site probably null
IGL03273:Stk40 APN 4 126123806 missense possibly damaging 0.94
R0562:Stk40 UTSW 4 126138801 splice site probably benign
R0639:Stk40 UTSW 4 126118332 nonsense probably null
R1432:Stk40 UTSW 4 126136833 missense probably damaging 1.00
R1888:Stk40 UTSW 4 126125745 missense probably damaging 1.00
R1888:Stk40 UTSW 4 126125745 missense probably damaging 1.00
R2119:Stk40 UTSW 4 126128847 missense probably benign 0.00
R2120:Stk40 UTSW 4 126128847 missense probably benign 0.00
R2122:Stk40 UTSW 4 126128847 missense probably benign 0.00
R4498:Stk40 UTSW 4 126129751 critical splice donor site probably null
R5964:Stk40 UTSW 4 126128895 missense probably damaging 0.99
R6868:Stk40 UTSW 4 126123814 missense probably damaging 0.99
R6902:Stk40 UTSW 4 126137812 missense probably benign 0.03
R7207:Stk40 UTSW 4 126125754 missense probably damaging 1.00
R7227:Stk40 UTSW 4 126123766 missense probably benign 0.01
R7304:Stk40 UTSW 4 126125690 missense probably benign 0.02
R7996:Stk40 UTSW 4 126136874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTCTCCTAAACAGAGG -3'
(R):5'- TAACCTGATGTGGGCATGTG -3'

Sequencing Primer
(F):5'- GCCTGTTTACAAGAATAGGAGGCTG -3'
(R):5'- CACTAGACCAGAGATCTTGTTCAGG -3'
Posted On2016-10-24