Incidental Mutation 'R5555:Fras1'
ID 435330
Institutional Source Beutler Lab
Gene Symbol Fras1
Ensembl Gene ENSMUSG00000034687
Gene Name Fraser extracellular matrix complex subunit 1
Synonyms bl, E130113P14Rik
MMRRC Submission 043112-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5555 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 96521814-96932587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96825236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1475 (H1475Q)
Ref Sequence ENSEMBL: ENSMUSP00000043250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036019]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036019
AA Change: H1475Q

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043250
Gene: ENSMUSG00000034687
AA Change: H1475Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 27 86 9.23e-9 SMART
VWC 94 151 9.37e-10 SMART
VWC 158 215 8.61e-9 SMART
VWC 220 277 7.1e-10 SMART
VWC 284 341 7.8e-7 SMART
VWC 365 415 1.93e-1 SMART
FU 408 459 3.33e-1 SMART
FU 461 504 9.12e-8 SMART
EGF_like 466 495 6.67e1 SMART
FU 506 552 6.01e-8 SMART
FU 554 598 2.21e-6 SMART
FU 601 646 1.28e-11 SMART
FU 648 704 4.19e-7 SMART
FU 707 752 9.12e-8 SMART
FU 754 799 1.11e-6 SMART
EGF_like 759 790 7.23e1 SMART
FU 802 851 5.44e-6 SMART
EGF_like 807 842 4.55e1 SMART
FU 853 899 7.4e-8 SMART
FU 902 947 4.78e-2 SMART
FU 951 996 4.52e-12 SMART
EGF_like 956 987 2.75e1 SMART
FU 998 1041 1.38e-7 SMART
FU 1045 1088 9.7e-3 SMART
EGF_like 1057 1096 3.16e1 SMART
Pfam:Cadherin_3 1098 1198 5.2e-12 PFAM
Pfam:Cadherin_3 1167 1309 6.5e-27 PFAM
Pfam:Cadherin_3 1278 1442 7e-24 PFAM
Pfam:Cadherin_3 1411 1560 1.3e-23 PFAM
Pfam:Cadherin_3 1561 1693 6.4e-15 PFAM
Pfam:Cadherin_3 1695 1814 1.1e-10 PFAM
Pfam:Cadherin_3 1780 1940 1.6e-18 PFAM
Pfam:Cadherin_3 1906 2061 2.8e-22 PFAM
Pfam:Cadherin_3 2063 2181 3.3e-18 PFAM
Pfam:Cadherin_3 2172 2295 1.4e-26 PFAM
Pfam:Cadherin_3 2296 2408 2.3e-31 PFAM
Pfam:Cadherin_3 2413 2540 7.9e-23 PFAM
Calx_beta 2544 2648 1.23e-10 SMART
Calx_beta 2661 2772 3.3e-11 SMART
Calx_beta 2787 2892 1.21e-9 SMART
Calx_beta 2907 3009 4.45e-3 SMART
Calx_beta 3027 3131 1.5e-14 SMART
Blast:Calx_beta 3162 3187 1e-5 BLAST
transmembrane domain 3902 3924 N/A INTRINSIC
low complexity region 3927 3935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Survival is variable on genetic backgrounds. Kidney development is severely affected and syndactyly is common. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg7 T C 6: 114,679,014 (GRCm39) V366A probably damaging Het
Cadm2 A T 16: 66,581,702 (GRCm39) V192E probably damaging Het
Chil6 C T 3: 106,297,268 (GRCm39) S291N possibly damaging Het
D7Ertd443e T C 7: 133,951,320 (GRCm39) T118A probably benign Het
Dennd4b G A 3: 90,175,675 (GRCm39) R148Q probably damaging Het
Dnah1 T A 14: 31,012,776 (GRCm39) T1837S probably damaging Het
Elapor2 T A 5: 9,472,296 (GRCm39) probably null Het
Ext1 A G 15: 52,951,539 (GRCm39) V515A probably damaging Het
Fer1l4 T C 2: 155,890,109 (GRCm39) E272G probably damaging Het
Grid1 T C 14: 35,242,662 (GRCm39) S672P possibly damaging Het
Gtpbp4 A G 13: 9,029,463 (GRCm39) probably null Het
Hsp90aa1 A T 12: 110,659,168 (GRCm39) V543E probably damaging Het
Irf5 T C 6: 29,531,145 (GRCm39) S4P probably benign Het
Kif2b G T 11: 91,466,286 (GRCm39) Q666K probably benign Het
Macc1 A T 12: 119,414,110 (GRCm39) H762L probably benign Het
Map1s C T 8: 71,369,751 (GRCm39) T941M probably damaging Het
Mrgprb1 T A 7: 48,097,523 (GRCm39) I130F probably benign Het
Nbeal1 T G 1: 60,276,311 (GRCm39) V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 (GRCm38) Q173* probably null Het
Plcb3 A T 19: 6,943,587 (GRCm39) M104K probably benign Het
Plcg2 T A 8: 118,339,734 (GRCm39) Y1048* probably null Het
Ptprf T C 4: 118,082,121 (GRCm39) Y1039C probably damaging Het
Rab38 A G 7: 88,079,695 (GRCm39) Y29C probably damaging Het
Rcan2 T A 17: 44,347,921 (GRCm39) V210E probably damaging Het
Rptn A T 3: 93,304,008 (GRCm39) Q447L probably benign Het
Scel G A 14: 103,839,642 (GRCm39) R495K probably benign Het
Scn11a G T 9: 119,584,304 (GRCm39) P1437Q probably damaging Het
Sim2 A G 16: 93,910,315 (GRCm39) D239G probably damaging Het
Skap2 A G 6: 51,836,998 (GRCm39) Y356H probably damaging Het
Skint11 A G 4: 114,051,798 (GRCm39) T49A probably benign Het
Snx33 G A 9: 56,832,681 (GRCm39) H463Y probably benign Het
Steap2 T C 5: 5,727,544 (GRCm39) T264A possibly damaging Het
Stk40 T A 4: 126,028,852 (GRCm39) V238E probably damaging Het
Sun2 T C 15: 79,618,328 (GRCm39) D277G probably benign Het
Ttll9 T C 2: 152,832,020 (GRCm39) probably null Het
Vmn1r54 G A 6: 90,246,347 (GRCm39) C87Y probably benign Het
Other mutations in Fras1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fras1 APN 5 96,887,217 (GRCm39) missense possibly damaging 0.55
IGL00507:Fras1 APN 5 96,926,048 (GRCm39) missense probably damaging 1.00
IGL00672:Fras1 APN 5 96,907,309 (GRCm39) splice site probably benign
IGL00772:Fras1 APN 5 96,783,971 (GRCm39) missense probably benign 0.42
IGL00844:Fras1 APN 5 96,682,712 (GRCm39) splice site probably benign
IGL00913:Fras1 APN 5 96,842,935 (GRCm39) missense probably damaging 0.99
IGL00959:Fras1 APN 5 96,929,140 (GRCm39) missense probably damaging 0.96
IGL00966:Fras1 APN 5 96,703,080 (GRCm39) missense probably benign 0.00
IGL01296:Fras1 APN 5 96,821,557 (GRCm39) missense probably null 0.58
IGL01307:Fras1 APN 5 96,929,551 (GRCm39) missense probably benign
IGL01481:Fras1 APN 5 96,805,100 (GRCm39) missense probably damaging 1.00
IGL01525:Fras1 APN 5 96,887,195 (GRCm39) missense probably damaging 0.99
IGL01599:Fras1 APN 5 96,857,750 (GRCm39) missense possibly damaging 0.94
IGL01646:Fras1 APN 5 96,906,007 (GRCm39) missense probably benign 0.29
IGL01795:Fras1 APN 5 96,925,904 (GRCm39) missense probably damaging 1.00
IGL01867:Fras1 APN 5 96,735,990 (GRCm39) missense probably benign
IGL01869:Fras1 APN 5 96,856,642 (GRCm39) splice site probably benign
IGL01923:Fras1 APN 5 96,883,139 (GRCm39) missense probably damaging 1.00
IGL01982:Fras1 APN 5 96,887,107 (GRCm39) missense possibly damaging 0.46
IGL02109:Fras1 APN 5 96,848,382 (GRCm39) missense probably benign
IGL02132:Fras1 APN 5 96,929,496 (GRCm39) nonsense probably null
IGL02171:Fras1 APN 5 96,883,040 (GRCm39) missense probably benign 0.15
IGL02213:Fras1 APN 5 96,793,730 (GRCm39) nonsense probably null
IGL02277:Fras1 APN 5 96,735,977 (GRCm39) missense probably benign 0.00
IGL02507:Fras1 APN 5 96,805,267 (GRCm39) missense possibly damaging 0.95
IGL02589:Fras1 APN 5 96,917,372 (GRCm39) missense probably damaging 1.00
IGL02671:Fras1 APN 5 96,876,475 (GRCm39) missense possibly damaging 0.91
IGL02677:Fras1 APN 5 96,692,883 (GRCm39) missense probably damaging 1.00
IGL02691:Fras1 APN 5 96,892,564 (GRCm39) missense possibly damaging 0.68
IGL02741:Fras1 APN 5 96,839,230 (GRCm39) missense probably benign 0.35
IGL02836:Fras1 APN 5 96,682,725 (GRCm39) missense possibly damaging 0.67
IGL02850:Fras1 APN 5 96,926,034 (GRCm39) missense probably damaging 1.00
IGL02998:Fras1 APN 5 96,850,040 (GRCm39) missense possibly damaging 0.82
IGL03040:Fras1 APN 5 96,857,960 (GRCm39) missense probably benign
IGL03078:Fras1 APN 5 96,783,994 (GRCm39) missense probably damaging 1.00
IGL03096:Fras1 APN 5 96,912,760 (GRCm39) missense probably damaging 1.00
IGL03102:Fras1 APN 5 96,874,394 (GRCm39) missense probably benign 0.11
IGL03183:Fras1 APN 5 96,881,640 (GRCm39) splice site probably benign
IGL03189:Fras1 APN 5 96,890,930 (GRCm39) missense probably benign 0.00
IGL03193:Fras1 APN 5 96,925,965 (GRCm39) missense probably damaging 0.99
IGL03292:Fras1 APN 5 96,855,350 (GRCm39) missense probably damaging 1.00
IGL03328:Fras1 APN 5 96,929,619 (GRCm39) missense probably damaging 0.96
IGL03335:Fras1 APN 5 96,881,803 (GRCm39) splice site probably benign
IGL03394:Fras1 APN 5 96,815,336 (GRCm39) missense probably damaging 0.98
IGL03404:Fras1 APN 5 96,876,440 (GRCm39) missense probably damaging 0.99
baby_ruth UTSW 5 96,856,617 (GRCm39) missense probably benign 0.01
BB002:Fras1 UTSW 5 96,929,443 (GRCm39) missense probably damaging 0.96
BB012:Fras1 UTSW 5 96,929,443 (GRCm39) missense probably damaging 0.96
G1patch:Fras1 UTSW 5 96,929,199 (GRCm39) missense possibly damaging 0.91
I0000:Fras1 UTSW 5 96,888,688 (GRCm39) missense probably damaging 0.99
PIT4581001:Fras1 UTSW 5 96,703,160 (GRCm39) missense probably benign 0.01
R0028:Fras1 UTSW 5 96,825,175 (GRCm39) missense probably benign 0.07
R0049:Fras1 UTSW 5 96,924,481 (GRCm39) missense probably benign 0.07
R0049:Fras1 UTSW 5 96,924,481 (GRCm39) missense probably benign 0.07
R0099:Fras1 UTSW 5 96,762,776 (GRCm39) critical splice donor site probably null
R0109:Fras1 UTSW 5 96,857,936 (GRCm39) missense probably benign 0.01
R0158:Fras1 UTSW 5 96,924,493 (GRCm39) missense possibly damaging 0.83
R0268:Fras1 UTSW 5 96,884,868 (GRCm39) missense probably damaging 0.99
R0305:Fras1 UTSW 5 96,744,747 (GRCm39) missense probably benign
R0352:Fras1 UTSW 5 96,874,399 (GRCm39) missense probably damaging 0.97
R0359:Fras1 UTSW 5 96,910,449 (GRCm39) missense probably damaging 0.98
R0371:Fras1 UTSW 5 96,703,190 (GRCm39) missense possibly damaging 0.90
R0379:Fras1 UTSW 5 96,903,368 (GRCm39) nonsense probably null
R0395:Fras1 UTSW 5 96,917,512 (GRCm39) missense possibly damaging 0.50
R0417:Fras1 UTSW 5 96,839,231 (GRCm39) missense probably benign 0.18
R0454:Fras1 UTSW 5 96,910,524 (GRCm39) missense probably damaging 0.96
R0456:Fras1 UTSW 5 96,862,202 (GRCm39) splice site probably null
R0456:Fras1 UTSW 5 96,702,647 (GRCm39) missense probably damaging 1.00
R0464:Fras1 UTSW 5 96,784,662 (GRCm39) missense probably damaging 0.98
R0613:Fras1 UTSW 5 96,848,347 (GRCm39) splice site probably benign
R0652:Fras1 UTSW 5 96,929,199 (GRCm39) missense possibly damaging 0.91
R0675:Fras1 UTSW 5 96,815,246 (GRCm39) splice site probably benign
R0765:Fras1 UTSW 5 96,700,655 (GRCm39) missense probably benign 0.00
R0783:Fras1 UTSW 5 96,916,289 (GRCm39) missense probably damaging 1.00
R0811:Fras1 UTSW 5 96,900,857 (GRCm39) missense probably benign 0.35
R0812:Fras1 UTSW 5 96,900,857 (GRCm39) missense probably benign 0.35
R0943:Fras1 UTSW 5 96,874,402 (GRCm39) missense probably benign 0.00
R1037:Fras1 UTSW 5 96,862,322 (GRCm39) missense probably damaging 0.97
R1104:Fras1 UTSW 5 96,856,530 (GRCm39) missense probably benign 0.00
R1108:Fras1 UTSW 5 96,790,488 (GRCm39) missense probably damaging 0.99
R1332:Fras1 UTSW 5 96,855,167 (GRCm39) missense probably benign 0.00
R1336:Fras1 UTSW 5 96,855,167 (GRCm39) missense probably benign 0.00
R1458:Fras1 UTSW 5 96,748,592 (GRCm39) missense probably benign 0.00
R1495:Fras1 UTSW 5 96,676,445 (GRCm39) missense possibly damaging 0.49
R1499:Fras1 UTSW 5 96,891,046 (GRCm39) missense probably benign 0.31
R1528:Fras1 UTSW 5 96,784,678 (GRCm39) missense probably damaging 0.99
R1532:Fras1 UTSW 5 96,861,855 (GRCm39) missense probably damaging 1.00
R1556:Fras1 UTSW 5 96,890,921 (GRCm39) missense possibly damaging 0.88
R1625:Fras1 UTSW 5 96,857,837 (GRCm39) missense possibly damaging 0.94
R1625:Fras1 UTSW 5 96,861,849 (GRCm39) missense probably damaging 1.00
R1645:Fras1 UTSW 5 96,848,445 (GRCm39) missense possibly damaging 0.90
R1647:Fras1 UTSW 5 96,874,472 (GRCm39) critical splice donor site probably null
R1648:Fras1 UTSW 5 96,874,472 (GRCm39) critical splice donor site probably null
R1661:Fras1 UTSW 5 96,746,768 (GRCm39) missense probably damaging 1.00
R1665:Fras1 UTSW 5 96,746,768 (GRCm39) missense probably damaging 1.00
R1682:Fras1 UTSW 5 96,793,732 (GRCm39) missense probably benign 0.00
R1701:Fras1 UTSW 5 96,748,643 (GRCm39) missense probably benign 0.00
R1716:Fras1 UTSW 5 96,700,584 (GRCm39) missense probably benign 0.10
R1718:Fras1 UTSW 5 96,702,748 (GRCm39) splice site probably null
R1800:Fras1 UTSW 5 96,857,741 (GRCm39) missense probably benign
R1806:Fras1 UTSW 5 96,912,835 (GRCm39) missense possibly damaging 0.88
R1806:Fras1 UTSW 5 96,861,829 (GRCm39) splice site probably benign
R1822:Fras1 UTSW 5 96,918,547 (GRCm39) missense probably damaging 1.00
R1823:Fras1 UTSW 5 96,918,547 (GRCm39) missense probably damaging 1.00
R1824:Fras1 UTSW 5 96,918,547 (GRCm39) missense probably damaging 1.00
R1847:Fras1 UTSW 5 96,897,282 (GRCm39) splice site probably null
R1929:Fras1 UTSW 5 96,815,296 (GRCm39) missense probably benign 0.24
R1951:Fras1 UTSW 5 96,860,242 (GRCm39) missense probably benign 0.38
R2093:Fras1 UTSW 5 96,929,062 (GRCm39) missense probably damaging 1.00
R2283:Fras1 UTSW 5 96,802,164 (GRCm39) missense probably benign 0.10
R2884:Fras1 UTSW 5 96,848,127 (GRCm39) missense probably benign 0.07
R2913:Fras1 UTSW 5 96,881,774 (GRCm39) missense probably benign
R2914:Fras1 UTSW 5 96,881,774 (GRCm39) missense probably benign
R3054:Fras1 UTSW 5 96,912,802 (GRCm39) missense probably damaging 0.99
R3117:Fras1 UTSW 5 96,919,571 (GRCm39) missense probably damaging 1.00
R3118:Fras1 UTSW 5 96,919,571 (GRCm39) missense probably damaging 1.00
R3691:Fras1 UTSW 5 96,929,371 (GRCm39) missense probably benign 0.02
R3714:Fras1 UTSW 5 96,793,829 (GRCm39) critical splice donor site probably null
R3715:Fras1 UTSW 5 96,793,829 (GRCm39) critical splice donor site probably null
R3801:Fras1 UTSW 5 96,881,791 (GRCm39) missense probably benign 0.26
R3961:Fras1 UTSW 5 96,825,244 (GRCm39) critical splice donor site probably null
R4065:Fras1 UTSW 5 96,918,542 (GRCm39) missense possibly damaging 0.64
R4066:Fras1 UTSW 5 96,918,542 (GRCm39) missense possibly damaging 0.64
R4076:Fras1 UTSW 5 96,891,017 (GRCm39) missense probably damaging 1.00
R4124:Fras1 UTSW 5 96,918,512 (GRCm39) missense probably benign 0.05
R4127:Fras1 UTSW 5 96,918,512 (GRCm39) missense probably benign 0.05
R4153:Fras1 UTSW 5 96,924,594 (GRCm39) missense probably benign 0.17
R4233:Fras1 UTSW 5 96,862,235 (GRCm39) missense possibly damaging 0.91
R4273:Fras1 UTSW 5 96,762,763 (GRCm39) missense probably benign 0.00
R4355:Fras1 UTSW 5 96,848,101 (GRCm39) missense probably benign
R4401:Fras1 UTSW 5 96,790,479 (GRCm39) missense probably damaging 0.97
R4402:Fras1 UTSW 5 96,790,479 (GRCm39) missense probably damaging 0.97
R4403:Fras1 UTSW 5 96,790,479 (GRCm39) missense probably damaging 0.97
R4505:Fras1 UTSW 5 96,929,207 (GRCm39) missense probably damaging 1.00
R4548:Fras1 UTSW 5 96,857,754 (GRCm39) missense probably benign 0.00
R4559:Fras1 UTSW 5 96,929,148 (GRCm39) missense probably damaging 1.00
R4629:Fras1 UTSW 5 96,924,593 (GRCm39) missense probably benign 0.00
R4637:Fras1 UTSW 5 96,925,947 (GRCm39) missense probably damaging 1.00
R4678:Fras1 UTSW 5 96,848,427 (GRCm39) missense probably benign 0.13
R4707:Fras1 UTSW 5 96,883,097 (GRCm39) missense probably damaging 0.96
R4735:Fras1 UTSW 5 96,736,022 (GRCm39) missense probably benign 0.00
R4756:Fras1 UTSW 5 96,929,518 (GRCm39) missense probably benign 0.00
R4762:Fras1 UTSW 5 96,879,477 (GRCm39) missense probably benign
R4820:Fras1 UTSW 5 96,876,512 (GRCm39) missense probably benign 0.00
R4847:Fras1 UTSW 5 96,692,851 (GRCm39) missense possibly damaging 0.94
R4857:Fras1 UTSW 5 96,926,018 (GRCm39) missense probably benign 0.00
R4909:Fras1 UTSW 5 96,856,617 (GRCm39) missense probably benign 0.01
R4931:Fras1 UTSW 5 96,784,699 (GRCm39) missense probably benign 0.02
R4938:Fras1 UTSW 5 96,924,583 (GRCm39) missense probably damaging 0.99
R4952:Fras1 UTSW 5 96,795,357 (GRCm39) missense probably benign 0.01
R4965:Fras1 UTSW 5 96,874,439 (GRCm39) missense possibly damaging 0.95
R4989:Fras1 UTSW 5 96,798,541 (GRCm39) missense possibly damaging 0.75
R5151:Fras1 UTSW 5 96,792,969 (GRCm39) missense probably damaging 1.00
R5168:Fras1 UTSW 5 96,856,616 (GRCm39) missense probably benign 0.00
R5182:Fras1 UTSW 5 96,784,032 (GRCm39) nonsense probably null
R5214:Fras1 UTSW 5 96,917,452 (GRCm39) missense probably damaging 1.00
R5220:Fras1 UTSW 5 96,916,222 (GRCm39) missense probably damaging 1.00
R5235:Fras1 UTSW 5 96,748,609 (GRCm39) missense probably benign 0.02
R5242:Fras1 UTSW 5 96,805,109 (GRCm39) missense probably benign 0.11
R5253:Fras1 UTSW 5 96,888,884 (GRCm39) missense probably damaging 0.99
R5260:Fras1 UTSW 5 96,883,046 (GRCm39) missense possibly damaging 0.79
R5301:Fras1 UTSW 5 96,805,125 (GRCm39) missense possibly damaging 0.88
R5411:Fras1 UTSW 5 96,793,019 (GRCm39) missense probably benign 0.00
R5467:Fras1 UTSW 5 96,927,912 (GRCm39) missense probably benign 0.04
R5543:Fras1 UTSW 5 96,676,394 (GRCm39) missense probably benign 0.01
R5602:Fras1 UTSW 5 96,884,880 (GRCm39) missense probably damaging 1.00
R5664:Fras1 UTSW 5 96,876,394 (GRCm39) missense possibly damaging 0.91
R5695:Fras1 UTSW 5 96,929,203 (GRCm39) missense probably damaging 1.00
R5717:Fras1 UTSW 5 96,929,596 (GRCm39) missense possibly damaging 0.93
R5742:Fras1 UTSW 5 96,916,240 (GRCm39) missense possibly damaging 0.50
R5759:Fras1 UTSW 5 96,857,775 (GRCm39) missense probably benign 0.02
R5766:Fras1 UTSW 5 96,879,548 (GRCm39) missense possibly damaging 0.91
R5890:Fras1 UTSW 5 96,793,807 (GRCm39) missense probably benign
R6052:Fras1 UTSW 5 96,912,725 (GRCm39) missense probably damaging 1.00
R6058:Fras1 UTSW 5 96,857,844 (GRCm39) missense probably benign
R6256:Fras1 UTSW 5 96,881,702 (GRCm39) missense possibly damaging 0.84
R6306:Fras1 UTSW 5 96,912,805 (GRCm39) missense probably damaging 1.00
R6494:Fras1 UTSW 5 96,907,423 (GRCm39) missense possibly damaging 0.59
R6638:Fras1 UTSW 5 96,905,953 (GRCm39) missense possibly damaging 0.94
R6647:Fras1 UTSW 5 96,883,061 (GRCm39) missense probably damaging 1.00
R6725:Fras1 UTSW 5 96,929,199 (GRCm39) missense possibly damaging 0.91
R6769:Fras1 UTSW 5 96,746,800 (GRCm39) missense possibly damaging 0.60
R6771:Fras1 UTSW 5 96,746,800 (GRCm39) missense possibly damaging 0.60
R6837:Fras1 UTSW 5 96,874,832 (GRCm39) missense probably damaging 0.99
R6841:Fras1 UTSW 5 96,876,410 (GRCm39) missense probably damaging 0.99
R6863:Fras1 UTSW 5 96,691,165 (GRCm39) missense probably benign 0.19
R6868:Fras1 UTSW 5 96,830,237 (GRCm39) missense probably benign 0.38
R6936:Fras1 UTSW 5 96,916,211 (GRCm39) missense possibly damaging 0.92
R6997:Fras1 UTSW 5 96,762,732 (GRCm39) nonsense probably null
R7023:Fras1 UTSW 5 96,857,943 (GRCm39) missense probably benign 0.00
R7091:Fras1 UTSW 5 96,856,535 (GRCm39) missense probably benign
R7102:Fras1 UTSW 5 96,718,900 (GRCm39) missense probably benign
R7120:Fras1 UTSW 5 96,900,819 (GRCm39) nonsense probably null
R7124:Fras1 UTSW 5 96,862,260 (GRCm39) missense probably damaging 1.00
R7129:Fras1 UTSW 5 96,929,143 (GRCm39) missense probably benign 0.00
R7173:Fras1 UTSW 5 96,925,937 (GRCm39) missense probably damaging 1.00
R7174:Fras1 UTSW 5 96,903,436 (GRCm39) critical splice donor site probably null
R7185:Fras1 UTSW 5 96,784,635 (GRCm39) missense probably damaging 1.00
R7191:Fras1 UTSW 5 96,762,771 (GRCm39) missense probably benign 0.05
R7216:Fras1 UTSW 5 96,887,173 (GRCm39) missense probably damaging 1.00
R7222:Fras1 UTSW 5 96,784,668 (GRCm39) missense probably benign 0.00
R7222:Fras1 UTSW 5 96,784,045 (GRCm39) missense probably damaging 1.00
R7320:Fras1 UTSW 5 96,857,745 (GRCm39) missense probably benign 0.03
R7335:Fras1 UTSW 5 96,884,829 (GRCm39) missense possibly damaging 0.82
R7378:Fras1 UTSW 5 96,744,644 (GRCm39) missense probably damaging 0.98
R7394:Fras1 UTSW 5 96,860,309 (GRCm39) nonsense probably null
R7412:Fras1 UTSW 5 96,762,748 (GRCm39) missense probably benign 0.06
R7422:Fras1 UTSW 5 96,821,458 (GRCm39) missense probably benign 0.21
R7552:Fras1 UTSW 5 96,916,297 (GRCm39) missense probably damaging 1.00
R7559:Fras1 UTSW 5 96,888,713 (GRCm39) missense possibly damaging 0.82
R7575:Fras1 UTSW 5 96,691,173 (GRCm39) missense probably benign 0.02
R7578:Fras1 UTSW 5 96,832,296 (GRCm39) missense probably damaging 1.00
R7600:Fras1 UTSW 5 96,832,295 (GRCm39) missense probably damaging 1.00
R7669:Fras1 UTSW 5 96,840,483 (GRCm39) missense probably benign 0.01
R7710:Fras1 UTSW 5 96,792,962 (GRCm39) nonsense probably null
R7722:Fras1 UTSW 5 96,917,413 (GRCm39) missense probably damaging 1.00
R7726:Fras1 UTSW 5 96,860,310 (GRCm39) missense probably benign 0.41
R7745:Fras1 UTSW 5 96,874,754 (GRCm39) missense probably benign 0.11
R7777:Fras1 UTSW 5 96,900,763 (GRCm39) missense probably damaging 1.00
R7923:Fras1 UTSW 5 96,887,177 (GRCm39) missense probably damaging 1.00
R7925:Fras1 UTSW 5 96,929,443 (GRCm39) missense probably damaging 0.96
R8000:Fras1 UTSW 5 96,910,536 (GRCm39) missense probably damaging 0.96
R8056:Fras1 UTSW 5 96,892,633 (GRCm39) missense probably damaging 1.00
R8058:Fras1 UTSW 5 96,842,778 (GRCm39) missense probably benign
R8117:Fras1 UTSW 5 96,855,245 (GRCm39) missense probably damaging 1.00
R8157:Fras1 UTSW 5 96,702,714 (GRCm39) missense probably benign 0.00
R8312:Fras1 UTSW 5 96,736,050 (GRCm39) missense probably benign
R8315:Fras1 UTSW 5 96,891,041 (GRCm39) missense probably damaging 0.97
R8412:Fras1 UTSW 5 96,744,711 (GRCm39) missense probably benign 0.00
R8546:Fras1 UTSW 5 96,857,825 (GRCm39) missense probably benign 0.00
R8705:Fras1 UTSW 5 96,839,260 (GRCm39) missense probably benign 0.01
R8790:Fras1 UTSW 5 96,903,236 (GRCm39) missense probably damaging 1.00
R8848:Fras1 UTSW 5 96,929,207 (GRCm39) missense probably damaging 1.00
R8855:Fras1 UTSW 5 96,917,465 (GRCm39) missense
R8871:Fras1 UTSW 5 96,855,257 (GRCm39) missense probably benign 0.34
R8894:Fras1 UTSW 5 96,907,402 (GRCm39) missense probably damaging 1.00
R8904:Fras1 UTSW 5 96,929,138 (GRCm39) missense probably benign 0.16
R8910:Fras1 UTSW 5 96,715,855 (GRCm39) missense probably benign 0.01
R8916:Fras1 UTSW 5 96,900,774 (GRCm39) missense probably damaging 1.00
R8929:Fras1 UTSW 5 96,917,366 (GRCm39) missense probably damaging 0.98
R8995:Fras1 UTSW 5 96,860,415 (GRCm39) missense possibly damaging 0.83
R9016:Fras1 UTSW 5 96,783,923 (GRCm39) missense probably damaging 0.96
R9021:Fras1 UTSW 5 96,888,609 (GRCm39) missense probably damaging 1.00
R9038:Fras1 UTSW 5 96,874,742 (GRCm39) missense probably benign 0.25
R9204:Fras1 UTSW 5 96,883,022 (GRCm39) missense probably damaging 1.00
R9222:Fras1 UTSW 5 96,805,087 (GRCm39) missense probably benign 0.15
R9231:Fras1 UTSW 5 96,692,904 (GRCm39) missense probably damaging 1.00
R9238:Fras1 UTSW 5 96,832,220 (GRCm39) missense possibly damaging 0.90
R9257:Fras1 UTSW 5 96,910,359 (GRCm39) missense probably damaging 1.00
R9302:Fras1 UTSW 5 96,682,751 (GRCm39) missense probably damaging 1.00
R9329:Fras1 UTSW 5 96,884,813 (GRCm39) missense probably damaging 1.00
R9361:Fras1 UTSW 5 96,924,557 (GRCm39) missense probably damaging 1.00
R9430:Fras1 UTSW 5 96,929,251 (GRCm39) missense probably benign 0.00
R9431:Fras1 UTSW 5 96,900,873 (GRCm39) missense possibly damaging 0.71
R9474:Fras1 UTSW 5 96,887,124 (GRCm39) missense probably benign 0.00
R9475:Fras1 UTSW 5 96,927,929 (GRCm39) missense probably damaging 0.96
R9497:Fras1 UTSW 5 96,884,895 (GRCm39) missense probably damaging 1.00
R9597:Fras1 UTSW 5 96,888,551 (GRCm39) missense probably damaging 1.00
R9650:Fras1 UTSW 5 96,910,387 (GRCm39) missense probably damaging 1.00
R9694:Fras1 UTSW 5 96,929,545 (GRCm39) missense probably benign 0.03
R9779:Fras1 UTSW 5 96,717,353 (GRCm39) missense probably damaging 0.99
Z1088:Fras1 UTSW 5 96,891,070 (GRCm39) missense probably damaging 0.97
Z1088:Fras1 UTSW 5 96,906,001 (GRCm39) missense probably benign
Z1176:Fras1 UTSW 5 96,906,001 (GRCm39) missense probably benign
Z1177:Fras1 UTSW 5 96,848,110 (GRCm39) missense possibly damaging 0.71
Z1177:Fras1 UTSW 5 96,839,316 (GRCm39) missense probably damaging 1.00
Z1177:Fras1 UTSW 5 96,906,001 (GRCm39) missense probably benign
Z1177:Fras1 UTSW 5 96,888,842 (GRCm39) missense possibly damaging 0.95
Z1177:Fras1 UTSW 5 96,888,670 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGTGAACATGCTCTACCCAG -3'
(R):5'- GGCACTGTAGCTATATGGGG -3'

Sequencing Primer
(F):5'- TGCTCTACCCAGTAGAAAACG -3'
(R):5'- GTGGTCAAGATAGGGTCTACATAATC -3'
Posted On 2016-10-24