Incidental Mutation 'R5555:Map1s'
ID435339
Institutional Source Beutler Lab
Gene Symbol Map1s
Ensembl Gene ENSMUSG00000019261
Gene Namemicrotubule-associated protein 1S
SynonymsBpy2ip1, Map8, VCY2IP1, 6430517J16Rik, Mtap1s
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5555 (G1)
Quality Score203
Status Not validated
Chromosome8
Chromosomal Location70905932-70917529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70917107 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 941 (T941M)
Ref Sequence ENSEMBL: ENSMUSP00000019405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019405] [ENSMUST00000212227] [ENSMUST00000213001]
Predicted Effect probably damaging
Transcript: ENSMUST00000019405
AA Change: T941M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019405
Gene: ENSMUSG00000019261
AA Change: T941M

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 125 137 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
SCOP:d1e5da2 237 300 2e-3 SMART
Blast:Lactamase_B 244 475 1e-85 BLAST
low complexity region 536 550 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
low complexity region 715 734 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
low complexity region 774 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212143
Predicted Effect probably benign
Transcript: ENSMUST00000212227
Predicted Effect probably benign
Transcript: ENSMUST00000213001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213083
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective biogenesis and degradation of autophagosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Map1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Map1s APN 8 70906029 unclassified probably benign
IGL01012:Map1s APN 8 70913910 missense probably benign 0.00
IGL01729:Map1s APN 8 70913068 missense probably damaging 1.00
IGL03158:Map1s APN 8 70914734 missense probably damaging 0.97
E0374:Map1s UTSW 8 70906017 unclassified probably benign
R0026:Map1s UTSW 8 70914638 missense probably damaging 1.00
R0172:Map1s UTSW 8 70914968 missense probably benign 0.00
R0571:Map1s UTSW 8 70912907 missense probably damaging 1.00
R0666:Map1s UTSW 8 70914052 missense possibly damaging 0.88
R0904:Map1s UTSW 8 70914188 missense probably damaging 0.96
R1617:Map1s UTSW 8 70913451 missense probably damaging 1.00
R1834:Map1s UTSW 8 70916411 missense probably damaging 0.97
R2134:Map1s UTSW 8 70913882 missense probably benign 0.00
R2143:Map1s UTSW 8 70910964 missense probably damaging 1.00
R3413:Map1s UTSW 8 70912519 missense probably damaging 0.99
R3870:Map1s UTSW 8 70917101 missense possibly damaging 0.82
R5784:Map1s UTSW 8 70914358 missense probably damaging 1.00
R6630:Map1s UTSW 8 70913798 missense probably damaging 1.00
R7379:Map1s UTSW 8 70913575 missense possibly damaging 0.87
R7569:Map1s UTSW 8 70913498 missense probably benign 0.05
Z1088:Map1s UTSW 8 70916449 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGGATGGCGCAACCTTAGTG -3'
(R):5'- TTAAGCACGGGATCTAGCTTTGC -3'

Sequencing Primer
(F):5'- GCAACCTTAGTGGCTGGTG -3'
(R):5'- GATCTAGCTTTGCACATGGAGCC -3'
Posted On2016-10-24