Mutagenetix > Incidental Mutations

Incidental Mutation 'R5555:Snx33'

435341

Institutional Source

Beutler Lab

Gene Symbol

Snx33

Ensembl Gene

ENSMUSG00000032733

Gene Name

sorting nexin 33

Synonyms

Sh3px3, E130307J07Rik

MMRRC Submission

043112-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R5555 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56917193-56928371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 56925397 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 463 (H463Y)

Ref Sequence

ENSEMBL: ENSMUSP00000060225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050916]

Predicted Effect

probably benign
Transcript: ENSMUST00000050916
AA Change: H463Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000060225
Gene: ENSMUSG00000032733
AA Change: H463Y

Domain	Start	End	E-Value	Type
SH3	3	60	3.2e-15	SMART
low complexity region	111	122	N/A	INTRINSIC
PX	227	336	6.69e-18	SMART
Pfam:BAR_3_WASP_bdg	337	572	1.1e-113	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cytoskeletal reorganization, vesicle trafficking, endocytosis, and mitosis. The encoded protein is essential for the creation of the cleavage furrow during mitosis and for completion of mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	A	5: 9,422,296		probably null	Het
Atg7	T	C	6: 114,702,053	V366A	probably damaging	Het
Cadm2	A	T	16: 66,784,815	V192E	probably damaging	Het
Chil6	C	T	3: 106,389,952	S291N	possibly damaging	Het
D7Ertd443e	T	C	7: 134,349,591	T118A	probably benign	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dnah1	T	A	14: 31,290,819	T1837S	probably damaging	Het
Ext1	A	G	15: 53,088,143	V515A	probably damaging	Het
Fer1l4	T	C	2: 156,048,189	E272G	probably damaging	Het
Fras1	T	A	5: 96,677,377	H1475Q	probably benign	Het
Grid1	T	C	14: 35,520,705	S672P	possibly damaging	Het
Gtpbp4	A	G	13: 8,979,427		probably null	Het
Hsp90aa1	A	T	12: 110,692,734	V543E	probably damaging	Het
Irf5	T	C	6: 29,531,146	S4P	probably benign	Het
Kif2b	G	T	11: 91,575,460	Q666K	probably benign	Het
Macc1	A	T	12: 119,450,375	H762L	probably benign	Het
Map1s	C	T	8: 70,917,107	T941M	probably damaging	Het
Mrgprb1	T	A	7: 48,447,775	I130F	probably benign	Het
Nbeal1	T	G	1: 60,237,152	V684G	possibly damaging	Het
Ngly1	C	T	14: 16,270,508	Q173*	probably null	Het
Plcb3	A	T	19: 6,966,219	M104K	probably benign	Het
Plcg2	T	A	8: 117,612,995	Y1048*	probably null	Het
Ptprf	T	C	4: 118,224,924	Y1039C	probably damaging	Het
Rab38	A	G	7: 88,430,487	Y29C	probably damaging	Het
Rcan2	T	A	17: 44,037,030	V210E	probably damaging	Het
Rptn	A	T	3: 93,396,701	Q447L	probably benign	Het
Scel	G	A	14: 103,602,206	R495K	probably benign	Het
Scn11a	G	T	9: 119,755,238	P1437Q	probably damaging	Het
Sim2	A	G	16: 94,109,456	D239G	probably damaging	Het
Skap2	A	G	6: 51,860,018	Y356H	probably damaging	Het
Skint11	A	G	4: 114,194,601	T49A	probably benign	Het
Steap2	T	C	5: 5,677,544	T264A	possibly damaging	Het
Stk40	T	A	4: 126,135,059	V238E	probably damaging	Het
Sun2	T	C	15: 79,734,127	D277G	probably benign	Het
Ttll9	T	C	2: 152,990,100		probably null	Het
Vmn1r54	G	A	6: 90,269,365	C87Y	probably benign	Het

Other mutations in Snx33

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02261:Snx33	APN	9	56926578	missense	probably benign
IGL02646:Snx33	APN	9	56926759	missense	probably damaging	1.00
IGL03028:Snx33	APN	9	56926451	missense	probably benign
R0206:Snx33	UTSW	9	56926224	missense	probably damaging	1.00
R0755:Snx33	UTSW	9	56925457	missense	possibly damaging	0.84
R1218:Snx33	UTSW	9	56925985	missense	probably damaging	1.00
R1523:Snx33	UTSW	9	56926182	missense	possibly damaging	0.47
R1627:Snx33	UTSW	9	56925957	missense	probably damaging	1.00
R1758:Snx33	UTSW	9	56926698	missense	probably benign	0.29
R1856:Snx33	UTSW	9	56926011	missense	possibly damaging	0.85
R1885:Snx33	UTSW	9	56925837	missense	probably benign	0.42
R2113:Snx33	UTSW	9	56926440	missense	probably benign	0.28
R2422:Snx33	UTSW	9	56918538	missense	probably benign	0.03
R3789:Snx33	UTSW	9	56918560	missense	probably benign	0.00
R3870:Snx33	UTSW	9	56926740	missense	probably benign	0.05
R3871:Snx33	UTSW	9	56926740	missense	probably benign	0.05
R4734:Snx33	UTSW	9	56925901	missense	possibly damaging	0.84
R4884:Snx33	UTSW	9	56926180	missense	probably damaging	0.99
R5069:Snx33	UTSW	9	56926191	missense	probably damaging	0.97
R6153:Snx33	UTSW	9	56926699	missense	possibly damaging	0.74
R7178:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7179:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7315:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7414:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7593:Snx33	UTSW	9	56926774	missense	possibly damaging	0.52
R7607:Snx33	UTSW	9	56926713	missense	probably benign
R7632:Snx33	UTSW	9	56926418	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CACACTTGTTGAGCAGCGAAG -3'
(R):5'- TACAGCTTAGCAACGTGGC -3'

Sequencing Primer
(F):5'- CTTGTTGAGCAGCGAAGGAGATG -3'
(R):5'- CGGAGCTGGTGCGGAAG -3'

Posted On

2016-10-24