Incidental Mutation 'R5555:Snx33'
ID435341
Institutional Source Beutler Lab
Gene Symbol Snx33
Ensembl Gene ENSMUSG00000032733
Gene Namesorting nexin 33
SynonymsSh3px3, E130307J07Rik
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location56917193-56928371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56925397 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 463 (H463Y)
Ref Sequence ENSEMBL: ENSMUSP00000060225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050916]
Predicted Effect probably benign
Transcript: ENSMUST00000050916
AA Change: H463Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060225
Gene: ENSMUSG00000032733
AA Change: H463Y

DomainStartEndE-ValueType
SH3 3 60 3.2e-15 SMART
low complexity region 111 122 N/A INTRINSIC
PX 227 336 6.69e-18 SMART
Pfam:BAR_3_WASP_bdg 337 572 1.1e-113 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cytoskeletal reorganization, vesicle trafficking, endocytosis, and mitosis. The encoded protein is essential for the creation of the cleavage furrow during mitosis and for completion of mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Snx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Snx33 APN 9 56926578 missense probably benign
IGL02646:Snx33 APN 9 56926759 missense probably damaging 1.00
IGL03028:Snx33 APN 9 56926451 missense probably benign
R0206:Snx33 UTSW 9 56926224 missense probably damaging 1.00
R0755:Snx33 UTSW 9 56925457 missense possibly damaging 0.84
R1218:Snx33 UTSW 9 56925985 missense probably damaging 1.00
R1523:Snx33 UTSW 9 56926182 missense possibly damaging 0.47
R1627:Snx33 UTSW 9 56925957 missense probably damaging 1.00
R1758:Snx33 UTSW 9 56926698 missense probably benign 0.29
R1856:Snx33 UTSW 9 56926011 missense possibly damaging 0.85
R1885:Snx33 UTSW 9 56925837 missense probably benign 0.42
R2113:Snx33 UTSW 9 56926440 missense probably benign 0.28
R2422:Snx33 UTSW 9 56918538 missense probably benign 0.03
R3789:Snx33 UTSW 9 56918560 missense probably benign 0.00
R3870:Snx33 UTSW 9 56926740 missense probably benign 0.05
R3871:Snx33 UTSW 9 56926740 missense probably benign 0.05
R4734:Snx33 UTSW 9 56925901 missense possibly damaging 0.84
R4884:Snx33 UTSW 9 56926180 missense probably damaging 0.99
R5069:Snx33 UTSW 9 56926191 missense probably damaging 0.97
R6153:Snx33 UTSW 9 56926699 missense possibly damaging 0.74
R7178:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7179:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7315:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7414:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7593:Snx33 UTSW 9 56926774 missense possibly damaging 0.52
R7607:Snx33 UTSW 9 56926713 missense probably benign
R7632:Snx33 UTSW 9 56926418 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACACTTGTTGAGCAGCGAAG -3'
(R):5'- TACAGCTTAGCAACGTGGC -3'

Sequencing Primer
(F):5'- CTTGTTGAGCAGCGAAGGAGATG -3'
(R):5'- CGGAGCTGGTGCGGAAG -3'
Posted On2016-10-24