Incidental Mutation 'R5555:Ngly1'
ID435347
Institutional Source Beutler Lab
Gene Symbol Ngly1
Ensembl Gene ENSMUSG00000021785
Gene NameN-glycanase 1
SynonymsPng1, PNGase, 1110002C09Rik
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16249280-16311926 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 16270508 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 173 (Q173*)
Ref Sequence ENSEMBL: ENSMUSP00000152998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022310] [ENSMUST00000223973] [ENSMUST00000224154] [ENSMUST00000224656]
Predicted Effect probably null
Transcript: ENSMUST00000022310
AA Change: Q173*
SMART Domains Protein: ENSMUSP00000022310
Gene: ENSMUSG00000021785
AA Change: Q173*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
PUG 30 91 1.83e-22 SMART
TGc 298 353 6.19e-14 SMART
Blast:PAW 376 415 2e-15 BLAST
low complexity region 416 433 N/A INTRINSIC
Blast:PAW 434 472 3e-15 BLAST
PAW 484 576 1.05e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223879
Predicted Effect probably null
Transcript: ENSMUST00000223973
AA Change: Q72*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224044
Predicted Effect probably null
Transcript: ENSMUST00000224154
AA Change: Q94*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224181
Predicted Effect probably null
Transcript: ENSMUST00000224656
AA Change: Q173*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226089
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysregulation of the endoplasmic reticulum (ER)-associated degradation (ERAD) process. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Skint11 A G 4: 114,194,601 T49A probably benign Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Ngly1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Ngly1 APN 14 16290873 missense probably benign 0.14
IGL02199:Ngly1 APN 14 16290844 missense probably damaging 0.96
IGL02809:Ngly1 APN 14 16281791 missense probably damaging 1.00
IGL02865:Ngly1 APN 14 16290939 intron probably benign
IGL03209:Ngly1 APN 14 16281831 nonsense probably null
IGL03290:Ngly1 APN 14 16281866 missense probably damaging 0.98
IGL02799:Ngly1 UTSW 14 16260636 missense probably benign
R0518:Ngly1 UTSW 14 16290774 nonsense probably null
R0521:Ngly1 UTSW 14 16290774 nonsense probably null
R1612:Ngly1 UTSW 14 16290867 nonsense probably null
R1851:Ngly1 UTSW 14 16260585 missense probably damaging 1.00
R2060:Ngly1 UTSW 14 16277877 missense possibly damaging 0.72
R2424:Ngly1 UTSW 14 16290721 intron probably null
R2696:Ngly1 UTSW 14 16283439 missense possibly damaging 0.52
R3834:Ngly1 UTSW 14 16290766 intron probably benign
R3883:Ngly1 UTSW 14 16270574 missense probably damaging 1.00
R4700:Ngly1 UTSW 14 16281809 missense probably benign 0.01
R5160:Ngly1 UTSW 14 16281751 missense probably damaging 0.98
R5603:Ngly1 UTSW 14 16260762 missense probably benign 0.01
R5764:Ngly1 UTSW 14 16260799 missense probably benign
R5980:Ngly1 UTSW 14 16270509 missense possibly damaging 0.85
R6066:Ngly1 UTSW 14 16294634 missense probably benign 0.01
R6887:Ngly1 UTSW 14 16281836 missense probably benign 0.02
R6943:Ngly1 UTSW 14 16283467 missense probably damaging 1.00
R7101:Ngly1 UTSW 14 16283445 missense probably damaging 1.00
R7447:Ngly1 UTSW 14 16290844 missense probably damaging 1.00
X0053:Ngly1 UTSW 14 16254743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGACAGGCCCCGATCTTAG -3'
(R):5'- TATAGTGTGCACATATAGCCAAAGG -3'

Sequencing Primer
(F):5'- AGACAGGCCCCGATCTTAGTATTG -3'
(R):5'- AGGCACTACTATCTAGCAATGATGC -3'
Posted On2016-10-24