Mutagenetix > Incidental Mutation

Incidental Mutation 'R5555:Scel'

435351

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

043112-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5555 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103602206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 495 (R495K)

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

probably benign
Transcript: ENSMUST00000095576
AA Change: R515K

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: R515K

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227322
AA Change: R495K

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	A	5: 9,422,296		probably null	Het
Atg7	T	C	6: 114,702,053	V366A	probably damaging	Het
Cadm2	A	T	16: 66,784,815	V192E	probably damaging	Het
Chil6	C	T	3: 106,389,952	S291N	possibly damaging	Het
D7Ertd443e	T	C	7: 134,349,591	T118A	probably benign	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dnah1	T	A	14: 31,290,819	T1837S	probably damaging	Het
Ext1	A	G	15: 53,088,143	V515A	probably damaging	Het
Fer1l4	T	C	2: 156,048,189	E272G	probably damaging	Het
Fras1	T	A	5: 96,677,377	H1475Q	probably benign	Het
Grid1	T	C	14: 35,520,705	S672P	possibly damaging	Het
Gtpbp4	A	G	13: 8,979,427		probably null	Het
Hsp90aa1	A	T	12: 110,692,734	V543E	probably damaging	Het
Irf5	T	C	6: 29,531,146	S4P	probably benign	Het
Kif2b	G	T	11: 91,575,460	Q666K	probably benign	Het
Macc1	A	T	12: 119,450,375	H762L	probably benign	Het
Map1s	C	T	8: 70,917,107	T941M	probably damaging	Het
Mrgprb1	T	A	7: 48,447,775	I130F	probably benign	Het
Nbeal1	T	G	1: 60,237,152	V684G	possibly damaging	Het
Ngly1	C	T	14: 16,270,508	Q173*	probably null	Het
Plcb3	A	T	19: 6,966,219	M104K	probably benign	Het
Plcg2	T	A	8: 117,612,995	Y1048*	probably null	Het
Ptprf	T	C	4: 118,224,924	Y1039C	probably damaging	Het
Rab38	A	G	7: 88,430,487	Y29C	probably damaging	Het
Rcan2	T	A	17: 44,037,030	V210E	probably damaging	Het
Rptn	A	T	3: 93,396,701	Q447L	probably benign	Het
Scn11a	G	T	9: 119,755,238	P1437Q	probably damaging	Het
Sim2	A	G	16: 94,109,456	D239G	probably damaging	Het
Skap2	A	G	6: 51,860,018	Y356H	probably damaging	Het
Skint11	A	G	4: 114,194,601	T49A	probably benign	Het
Snx33	G	A	9: 56,925,397	H463Y	probably benign	Het
Steap2	T	C	5: 5,677,544	T264A	possibly damaging	Het
Stk40	T	A	4: 126,135,059	V238E	probably damaging	Het
Sun2	T	C	15: 79,734,127	D277G	probably benign	Het
Ttll9	T	C	2: 152,990,100		probably null	Het
Vmn1r54	G	A	6: 90,269,365	C87Y	probably benign	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9614:Scel	UTSW	14	103605596	missense	probably damaging	1.00
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
R9719:Scel	UTSW	14	103572006	critical splice acceptor site	probably null
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GTACCTGTGCAGAAACCAGG -3'
(R):5'- GACTTTAAAGCAACAGCTACGTTC -3'

Sequencing Primer
(F):5'- GTAGAGGTAAAGAAATATTGTCCTCC -3'
(R):5'- TATGTCCCAGCAATCACTGAG -3'

Posted On

2016-10-24