Mutagenetix > Incidental Mutations

Incidental Mutation 'R5556:Dis3l2'

435361

Institutional Source

Beutler Lab

Gene Symbol

Dis3l2

Ensembl Gene

ENSMUSG00000053333

Gene Name

DIS3 like 3'-5' exoribonuclease 2

Synonyms

4930429A22Rik, 8030493P09Rik

MMRRC Submission

043113-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.361) question?

Stock #

R5556 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86703808-87050095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86973404 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 439 (V439A)

Ref Sequence

ENSEMBL: ENSMUSP00000070506 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]

PDB Structure

Structure of mouse Dis3L2 in complex with oligoU RNA substrate [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065694
AA Change: V439A

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: V439A

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	369	719	8.9e-140	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168237
AA Change: V453A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: V453A

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	383	733	8.9e-140	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185304

Predicted Effect

probably benign
Transcript: ENSMUST00000190618

SMART Domains

Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
PDB:2VNU\|D	50	123	4e-10	PDB

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,693,167	Q456K	probably benign	Het
4933427D14Rik	T	A	11: 72,175,200		probably null	Het
Abca13	A	T	11: 9,258,546	I240F	possibly damaging	Het
Accs	A	G	2: 93,836,083	Y420H	probably damaging	Het
Aco2	T	C	15: 81,889,319	Y20H	probably damaging	Het
Adck2	T	C	6: 39,583,935	V419A	probably benign	Het
Bahd1	T	A	2: 118,916,270	N123K	probably damaging	Het
BC027072	T	C	17: 71,752,425	K86E	possibly damaging	Het
Cast	A	G	13: 74,695,889		probably null	Het
Cd164l2	T	A	4: 133,223,705	V157E	probably damaging	Het
Cdk11b	C	T	4: 155,634,147	Q185*	probably null	Het
Ces2g	T	C	8: 104,967,442	F470S	probably benign	Het
Cherp	C	G	8: 72,467,980	Q313H	probably damaging	Het
Chrna4	A	G	2: 181,033,980	V110A	possibly damaging	Het
Cndp2	A	G	18: 84,672,124	V231A	probably benign	Het
Cst7	A	T	2: 150,570,568	H17L	probably benign	Het
Decr1	C	T	4: 15,919,244	D300N	probably damaging	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dgkb	T	G	12: 38,127,364	V230G	probably damaging	Het
Disp3	C	T	4: 148,258,157	G612D	probably benign	Het
Dock7	T	C	4: 98,944,735	T1962A	probably damaging	Het
Fam189a1	A	G	7: 64,856,209	F96S	probably damaging	Het
Fibp	T	A	19: 5,464,199	V304E	possibly damaging	Het
Flt3	T	A	5: 147,332,997		probably null	Het
Kifc3	G	A	8: 95,108,459	Q233*	probably null	Het
Klhl42	C	A	6: 147,108,112	S483Y	probably benign	Het
Map3k19	G	A	1: 127,834,547	R276*	probably null	Het
Mecom	A	G	3: 30,238,100	S87P	probably damaging	Het
Med13	A	G	11: 86,327,838	V416A	probably benign	Het
Mepe	G	A	5: 104,338,212	G406D	probably damaging	Het
Met	T	G	6: 17,534,176	L673V	probably benign	Het
Mlh3	A	T	12: 85,268,493	Y306*	probably null	Het
Nrxn2	C	A	19: 6,490,091	A814E	probably damaging	Het
Nsmaf	C	T	4: 6,398,621	V828I	probably benign	Het
Olfr137	T	A	17: 38,305,073	K129N	possibly damaging	Het
Olfr824	A	T	10: 130,126,859	L66H	probably damaging	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pcdhb6	T	A	18: 37,334,389	L121Q	probably damaging	Het
Plekha7	G	A	7: 116,164,149	T406I	probably benign	Het
Prtg	T	C	9: 72,851,704	S447P	probably damaging	Het
Ptprr	A	G	10: 116,251,149	Y267C	probably damaging	Het
Rbpjl	A	G	2: 164,408,062	T134A	probably benign	Het
Rpe	C	A	1: 66,706,466	T55N	probably damaging	Het
Scn1a	T	C	2: 66,324,797	D606G	probably benign	Het
Setd5	T	A	6: 113,147,502	N1105K	probably benign	Het
Sh3d21	T	C	4: 126,162,236	N126D	possibly damaging	Het
Shank1	A	G	7: 44,344,315		probably benign	Het
Srgap3	T	A	6: 112,739,078	D627V	probably damaging	Het
Tacc2	T	A	7: 130,674,606	S1796T	probably damaging	Het
Tcrg-C4	A	T	13: 19,352,307	R178S	unknown	Het
Tmco3	G	A	8: 13,294,870	V217I	probably damaging	Het
Tspan10	A	T	11: 120,444,715	Y217F	possibly damaging	Het
Usp3	G	A	9: 66,544,021	T153M	possibly damaging	Het
Xdh	G	T	17: 73,897,764	T1067K	probably benign	Het
Zfp334	T	C	2: 165,380,584	D513G	probably benign	Het

Other mutations in Dis3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Dis3l2	APN	1	86857203	missense	probably benign	0.00
IGL01607:Dis3l2	APN	1	86745487	missense	probably benign	0.04
IGL02233:Dis3l2	APN	1	86990231	missense	probably damaging	1.00
IGL02698:Dis3l2	APN	1	87048829	splice site	probably benign
R0514:Dis3l2	UTSW	1	87047092	missense	probably damaging	1.00
R0893:Dis3l2	UTSW	1	87044206	splice site	probably null
R1086:Dis3l2	UTSW	1	86990149	missense	probably benign	0.36
R1140:Dis3l2	UTSW	1	86821438	missense	probably benign	0.00
R1509:Dis3l2	UTSW	1	87021086	missense	possibly damaging	0.91
R2029:Dis3l2	UTSW	1	86854467	splice site	probably benign
R2511:Dis3l2	UTSW	1	86990258	missense	probably benign	0.05
R3772:Dis3l2	UTSW	1	86854408	missense	probably benign
R4163:Dis3l2	UTSW	1	86821237	missense	probably benign	0.00
R4547:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4548:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4650:Dis3l2	UTSW	1	86990321	missense	possibly damaging	0.83
R4810:Dis3l2	UTSW	1	87047574	missense	probably damaging	0.99
R4936:Dis3l2	UTSW	1	87044168	missense	probably benign	0.00
R5010:Dis3l2	UTSW	1	86760321	missense	probably benign	0.21
R5040:Dis3l2	UTSW	1	86857337	missense	probably damaging	0.98
R5272:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5500:Dis3l2	UTSW	1	87021119	critical splice donor site	probably null
R5772:Dis3l2	UTSW	1	86878432	missense	probably damaging	1.00
R5808:Dis3l2	UTSW	1	87049638	missense	possibly damaging	0.94
R5950:Dis3l2	UTSW	1	87021108	missense	probably damaging	0.96
R6328:Dis3l2	UTSW	1	86854431	missense	probably benign	0.05
R6553:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6585:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6905:Dis3l2	UTSW	1	87044839	missense	probably benign	0.00
R6921:Dis3l2	UTSW	1	86857341	missense	probably benign
R7162:Dis3l2	UTSW	1	87044030	missense	possibly damaging	0.94
R7270:Dis3l2	UTSW	1	86990303	missense	possibly damaging	0.49
R7438:Dis3l2	UTSW	1	86745500	critical splice donor site	probably null
X0027:Dis3l2	UTSW	1	86760351	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CTACAAACAGTGACAGTGTTTCTG -3'
(R):5'- CACGGTGCTTACCACAAGAG -3'

Sequencing Primer
(F):5'- TACTTCCCAGGCAGAGCTGAG -3'
(R):5'- CGGTGCTTACCACAAGAGATAGG -3'

Posted On

2016-10-24