Incidental Mutation 'R5556:Rbpjl'
List |< first << previous [record 43 of 56] next >> last >|
ID435368
Institutional Source Beutler Lab
Gene Symbol Rbpjl
Ensembl Gene ENSMUSG00000017007
Gene Namerecombination signal binding protein for immunoglobulin kappa J region-like
SynonymsRBP-J kappa-like, Rbpsuhl, RBP-L
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164403141-164415448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164408062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Ref Sequence ENSEMBL: ENSMUSP00000017151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017151] [ENSMUST00000103103] [ENSMUST00000103104] [ENSMUST00000109358] [ENSMUST00000109359]
Predicted Effect probably benign
Transcript: ENSMUST00000017151
AA Change: T134A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000017151
Gene: ENSMUSG00000017007
AA Change: T134A

DomainStartEndE-ValueType
LAG1_DNAbind 66 204 4.58e-78 SMART
BTD 205 357 1.23e-83 SMART
SCOP:d1a02n1 383 475 3e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103103
SMART Domains Protein: ENSMUSP00000099392
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103104
SMART Domains Protein: ENSMUSP00000099393
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109356
Predicted Effect probably benign
Transcript: ENSMUST00000109358
SMART Domains Protein: ENSMUSP00000104982
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.85e0 SMART
EGF 261 298 1.24e-1 SMART
VWA 304 482 6.72e-56 SMART
Matrilin_ccoil 492 539 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109359
SMART Domains Protein: ENSMUSP00000104983
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 3.43e-4 SMART
EGF 261 298 1.85e0 SMART
EGF 302 339 1.24e-1 SMART
VWA 345 523 6.72e-56 SMART
Matrilin_ccoil 533 580 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154940
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of hairless protein family. A similar protein in mouse is a transcription factor that binds to DNA sequences almost identical to that bound by the Notch receptor signaling pathway transcription factor recombining binding protein J. The mouse protein has been shown to activate transcription in concert with Epstein-Barr virus nuclear antigen-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene do not display any obvious phenotype abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Rbpjl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Rbpjl APN 2 164407785 missense possibly damaging 0.74
IGL02429:Rbpjl APN 2 164413895 missense possibly damaging 0.80
R2155:Rbpjl UTSW 2 164414423 missense possibly damaging 0.80
R2244:Rbpjl UTSW 2 164403217 intron probably benign
R2344:Rbpjl UTSW 2 164414392 missense probably damaging 0.99
R4721:Rbpjl UTSW 2 164404527 missense probably benign 0.08
R5023:Rbpjl UTSW 2 164410289 missense probably damaging 1.00
R5492:Rbpjl UTSW 2 164414410 frame shift probably null
R5493:Rbpjl UTSW 2 164414410 frame shift probably null
R5494:Rbpjl UTSW 2 164414410 frame shift probably null
R5796:Rbpjl UTSW 2 164410248 splice site probably benign
R6164:Rbpjl UTSW 2 164410879 missense probably damaging 1.00
R7609:Rbpjl UTSW 2 164405814 missense probably benign 0.05
R8025:Rbpjl UTSW 2 164410246 splice site probably benign
R8068:Rbpjl UTSW 2 164408518 missense possibly damaging 0.93
R8251:Rbpjl UTSW 2 164413934 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTGCAGGAAGGACCAAC -3'
(R):5'- TAGGGACTAGGTCAGAACCCAC -3'

Sequencing Primer
(F):5'- GGAAGGACCAACTGCCTCAG -3'
(R):5'- TCTGATGCTCTCTAGTGC -3'
Posted On2016-10-24