Incidental Mutation 'R5556:Chrna4'
List |< first << previous [record 14 of 56] next >> last >|
ID435370
Institutional Source Beutler Lab
Gene Symbol Chrna4
Ensembl Gene ENSMUSG00000027577
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 4
Synonymsalpha4 nAChR, Acra-4, a4 nicotinic receptor, Acra4, alpha4-nAChR
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181018380-181043546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181033980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000104479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067120] [ENSMUST00000108851] [ENSMUST00000124400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067120
AA Change: V110A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066338
Gene: ENSMUSG00000027577
AA Change: V110A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 1.4e-76 PFAM
Pfam:Neur_chan_memb 252 620 1.9e-107 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108851
AA Change: V110A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104479
Gene: ENSMUSG00000027577
AA Change: V110A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 8.4e-79 PFAM
Pfam:Neur_chan_memb 252 620 3.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124400
SMART Domains Protein: ENSMUSP00000123043
Gene: ENSMUSG00000027577

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 22 78 3.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135766
SMART Domains Protein: ENSMUSP00000125724
Gene: ENSMUSG00000027577

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 130 9.2e-37 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nicotinic acetylcholine receptor, which belongs to a superfamily of ligand-gated ion channels that play a role in fast signal transmission at synapses. These pentameric receptors can bind acetylcholine, which causes an extensive change in conformation that leads to the opening of an ion-conducting channel across the plasma membrane. This protein is an integral membrane receptor subunit that can interact with either nAChR beta-2 or nAChR beta-4 to form a functional receptor. Mutations in this gene cause nocturnal frontal lobe epilepsy type 1. Polymorphisms in this gene that provide protection against nicotine addiction have been described. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice may show reduced chemically-elicited analgesia, susceptibility to seizures, increased anxiety, and altered behavioral responses to nicotine or a new environment. Homozygotes for any of several knock-in alleles exhibit altered nervous system physiology and/or sensitivity to nicotine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Chrna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Chrna4 APN 2 181029391 missense probably benign 0.09
IGL00914:Chrna4 APN 2 181029031 missense probably damaging 1.00
IGL01511:Chrna4 APN 2 181028668 missense probably benign 0.13
IGL02517:Chrna4 APN 2 181029133 missense probably benign 0.01
IGL02715:Chrna4 APN 2 181029581 unclassified probably benign
R1168:Chrna4 UTSW 2 181034138 missense possibly damaging 0.61
R1475:Chrna4 UTSW 2 181029379 missense probably benign 0.44
R1572:Chrna4 UTSW 2 181029307 missense possibly damaging 0.95
R4428:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4429:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4431:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4494:Chrna4 UTSW 2 181028488 missense probably damaging 0.98
R4664:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R4666:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R4931:Chrna4 UTSW 2 181028872 missense probably benign 0.00
R5144:Chrna4 UTSW 2 181024830 missense probably damaging 1.00
R5633:Chrna4 UTSW 2 181029460 missense probably damaging 1.00
R5889:Chrna4 UTSW 2 181028658 missense probably damaging 1.00
R6056:Chrna4 UTSW 2 181029442 missense probably damaging 1.00
R6120:Chrna4 UTSW 2 181024806 missense probably damaging 1.00
R7030:Chrna4 UTSW 2 181029541 missense probably damaging 1.00
R7352:Chrna4 UTSW 2 181037474 missense probably damaging 0.97
R7694:Chrna4 UTSW 2 181018593 missense
R7945:Chrna4 UTSW 2 181028661 missense probably benign 0.04
R8075:Chrna4 UTSW 2 181039066 missense unknown
R8706:Chrna4 UTSW 2 181037514 missense probably damaging 1.00
Z1177:Chrna4 UTSW 2 181024813 missense probably damaging 1.00
Z1177:Chrna4 UTSW 2 181028285 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACAAGCAGAGCTGGAAGTCC -3'
(R):5'- CTTACTTGTGCCCTAGGATGAG -3'

Sequencing Primer
(F):5'- CTCCAGACTTGAGAGCAGGTATC -3'
(R):5'- CTTGTGCCCTAGGATGAGAAAAACC -3'
Posted On2016-10-24