Incidental Mutation 'R5556:Dennd4b'
ID435372
Institutional Source Beutler Lab
Gene Symbol Dennd4b
Ensembl Gene ENSMUSG00000042404
Gene NameDENN/MADD domain containing 4B
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90265185-90280669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90268368 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 148 (R148Q)
Ref Sequence ENSEMBL: ENSMUSP00000117354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029545] [ENSMUST00000098914] [ENSMUST00000129564] [ENSMUST00000184882]
Predicted Effect probably benign
Transcript: ENSMUST00000029545
SMART Domains Protein: ENSMUSP00000029545
Gene: ENSMUSG00000027936

DomainStartEndE-ValueType
Pfam:TORC_N 18 72 1.8e-20 PFAM
low complexity region 127 141 N/A INTRINSIC
Pfam:TORC_M 168 323 3.7e-71 PFAM
low complexity region 335 384 N/A INTRINSIC
low complexity region 391 416 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 484 494 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Pfam:TORC_C 614 691 4.3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098914
AA Change: R159Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096514
Gene: ENSMUSG00000042404
AA Change: R159Q

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
uDENN 183 290 1.15e-29 SMART
DENN 324 508 5.26e-70 SMART
dDENN 573 647 1.75e-25 SMART
low complexity region 672 690 N/A INTRINSIC
low complexity region 740 752 N/A INTRINSIC
coiled coil region 902 928 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1131 1148 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1424 1439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129564
AA Change: R148Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404
AA Change: R148Q

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149422
Predicted Effect probably benign
Transcript: ENSMUST00000151648
SMART Domains Protein: ENSMUSP00000121350
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
uDENN 2 57 3.71e-6 SMART
Pfam:DENN 91 157 2.9e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156358
AA Change: R139Q
SMART Domains Protein: ENSMUSP00000118483
Gene: ENSMUSG00000042404
AA Change: R139Q

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Blast:uDENN 39 97 9e-6 BLAST
Blast:uDENN 164 207 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183900
Predicted Effect probably benign
Transcript: ENSMUST00000184882
SMART Domains Protein: ENSMUSP00000139194
Gene: ENSMUSG00000027936

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:TORC_M 83 239 6.5e-65 PFAM
low complexity region 250 299 N/A INTRINSIC
low complexity region 306 331 N/A INTRINSIC
low complexity region 347 354 N/A INTRINSIC
low complexity region 399 409 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
Meta Mutation Damage Score 0.1589 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Dennd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dennd4b APN 3 90271207 missense possibly damaging 0.83
IGL00834:Dennd4b APN 3 90279686 critical splice donor site probably null
IGL01124:Dennd4b APN 3 90269074 missense possibly damaging 0.61
IGL01792:Dennd4b APN 3 90279845 missense probably damaging 0.96
IGL01895:Dennd4b APN 3 90275567 missense probably benign 0.00
IGL02533:Dennd4b APN 3 90272310 missense probably benign 0.02
IGL02630:Dennd4b APN 3 90272977 missense probably benign 0.00
R0107:Dennd4b UTSW 3 90272736 missense possibly damaging 0.92
R0143:Dennd4b UTSW 3 90272364 missense probably damaging 1.00
R1079:Dennd4b UTSW 3 90271178 missense probably benign
R1306:Dennd4b UTSW 3 90271165 missense probably benign 0.00
R1525:Dennd4b UTSW 3 90270870 missense probably damaging 0.97
R1756:Dennd4b UTSW 3 90271605 missense probably damaging 1.00
R1959:Dennd4b UTSW 3 90268773 missense probably damaging 1.00
R1976:Dennd4b UTSW 3 90273055 missense probably damaging 1.00
R2184:Dennd4b UTSW 3 90275540 missense probably damaging 1.00
R2296:Dennd4b UTSW 3 90275514 missense probably damaging 1.00
R2406:Dennd4b UTSW 3 90275488 missense probably damaging 1.00
R2408:Dennd4b UTSW 3 90271575 nonsense probably null
R4691:Dennd4b UTSW 3 90272312 missense probably damaging 1.00
R5376:Dennd4b UTSW 3 90278056 missense probably benign 0.00
R5466:Dennd4b UTSW 3 90268500 splice site probably null
R5555:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5557:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5605:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5617:Dennd4b UTSW 3 90275626 missense probably benign
R5692:Dennd4b UTSW 3 90277783 missense probably damaging 1.00
R5790:Dennd4b UTSW 3 90277450 missense probably damaging 1.00
R5957:Dennd4b UTSW 3 90270965 missense probably damaging 1.00
R6130:Dennd4b UTSW 3 90276259 missense probably damaging 1.00
R6183:Dennd4b UTSW 3 90275568 utr 3 prime probably benign
R6505:Dennd4b UTSW 3 90267611 missense probably damaging 1.00
R6631:Dennd4b UTSW 3 90277732 splice site probably null
R6801:Dennd4b UTSW 3 90268779 missense probably damaging 0.98
R7409:Dennd4b UTSW 3 90273952 missense probably benign 0.15
R7457:Dennd4b UTSW 3 90269315 missense probably benign
R7650:Dennd4b UTSW 3 90268749 nonsense probably null
X0024:Dennd4b UTSW 3 90270971 missense possibly damaging 0.78
Z1176:Dennd4b UTSW 3 90279495 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCAGGTTTAGGAGACCAG -3'
(R):5'- AAATACCCTTTGTGCCGCC -3'

Sequencing Primer
(F):5'- AGCAGGATCCAAGACTCTTTCTATC -3'
(R):5'- ATACCCTTACACTAGTTCTTCAGG -3'
Posted On2016-10-24