Incidental Mutation 'R5556:Nsmaf'
ID435373
Institutional Source Beutler Lab
Gene Symbol Nsmaf
Ensembl Gene ENSMUSG00000028245
Gene Nameneutral sphingomyelinase (N-SMase) activation associated factor
SynonymsFan, factor associated with N-SMase activation
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location6396207-6454271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6398621 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 828 (V828I)
Ref Sequence ENSEMBL: ENSMUSP00000029910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000029912] [ENSMUST00000103008] [ENSMUST00000108374]
Predicted Effect probably benign
Transcript: ENSMUST00000029910
AA Change: V828I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245
AA Change: V828I

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029912
SMART Domains Protein: ENSMUSP00000029912
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
PDZ 208 274 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103008
SMART Domains Protein: ENSMUSP00000100073
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
PDZ 207 273 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108374
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156715
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor. This protein is required for TNF-mediated activation of neutral sphingomyelinase and may play a role in regulating TNF-induced cellular responses such as inflammation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation show no gross phenotypic abnormalities but display delayed cutaneous barrier repair. In addition, D-galactosamine-sensitized homozygotes are partially resistant to LPS- and TNF-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Nsmaf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Nsmaf APN 4 6417163 critical splice donor site probably null
IGL00778:Nsmaf APN 4 6435056 critical splice donor site probably null
IGL01775:Nsmaf APN 4 6396791 missense possibly damaging 0.79
IGL02003:Nsmaf APN 4 6418522 missense probably benign 0.02
IGL02039:Nsmaf APN 4 6424995 splice site probably benign
IGL02085:Nsmaf APN 4 6398551 missense probably benign 0.21
IGL02252:Nsmaf APN 4 6398378 missense probably benign 0.00
IGL02655:Nsmaf APN 4 6424933 missense possibly damaging 0.94
R0023:Nsmaf UTSW 4 6408680 missense probably damaging 0.96
R0454:Nsmaf UTSW 4 6424874 splice site probably null
R0538:Nsmaf UTSW 4 6419930 splice site probably null
R0605:Nsmaf UTSW 4 6418470 critical splice donor site probably null
R1033:Nsmaf UTSW 4 6438054 missense probably damaging 1.00
R1472:Nsmaf UTSW 4 6423448 nonsense probably null
R1519:Nsmaf UTSW 4 6438062 missense probably benign 0.06
R1641:Nsmaf UTSW 4 6409884 missense probably benign 0.01
R1668:Nsmaf UTSW 4 6398880 missense probably damaging 0.98
R2212:Nsmaf UTSW 4 6396732 missense probably damaging 0.99
R2351:Nsmaf UTSW 4 6437921 missense probably damaging 1.00
R3862:Nsmaf UTSW 4 6435064 missense probably benign 0.00
R4112:Nsmaf UTSW 4 6417188 nonsense probably null
R4644:Nsmaf UTSW 4 6419940 splice site probably benign
R4807:Nsmaf UTSW 4 6398542 splice site probably null
R4960:Nsmaf UTSW 4 6423342 missense probably damaging 1.00
R5936:Nsmaf UTSW 4 6421017 intron probably benign
R7288:Nsmaf UTSW 4 6416641 missense probably benign
R7295:Nsmaf UTSW 4 6438083 missense probably benign 0.00
R7378:Nsmaf UTSW 4 6416586 missense probably benign
R7615:Nsmaf UTSW 4 6408563 missense probably damaging 1.00
R7842:Nsmaf UTSW 4 6435109 critical splice acceptor site probably null
R7993:Nsmaf UTSW 4 6398647 missense probably benign 0.15
R8737:Nsmaf UTSW 4 6396748 missense probably benign 0.15
X0021:Nsmaf UTSW 4 6398543 critical splice donor site probably null
X0063:Nsmaf UTSW 4 6414962 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCATGATCAGGAGACAGTCTG -3'
(R):5'- AGGGACAGTATGTGATGCTGC -3'

Sequencing Primer
(F):5'- GTCATAAAAAGTATGTGACCCTGGCC -3'
(R):5'- AGCCCAGGTACGTGTTATCC -3'
Posted On2016-10-24