Incidental Mutation 'R5556:Decr1'
ID435374
Institutional Source Beutler Lab
Gene Symbol Decr1
Ensembl Gene ENSMUSG00000028223
Gene Name2,4-dienoyl CoA reductase 1, mitochondrial
SynonymsNadph, 1200012F07Rik, Decr
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location15917240-15945507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15919244 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 300 (D300N)
Ref Sequence ENSEMBL: ENSMUSP00000029877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029877]
Predicted Effect probably damaging
Transcript: ENSMUST00000029877
AA Change: D300N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029877
Gene: ENSMUSG00000028223
AA Change: D300N

DomainStartEndE-ValueType
Pfam:adh_short 60 253 7.7e-34 PFAM
Pfam:KR 61 182 4.3e-9 PFAM
Pfam:adh_short_C2 66 304 2e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an accessory enzyme which participates in the beta-oxidation and metabolism of unsaturated fatty enoyl-CoA esters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to fasting and cold stresses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Decr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Decr1 APN 4 15933056 missense probably benign 0.23
IGL02736:Decr1 APN 4 15930952 missense probably benign 0.01
IGL03141:Decr1 APN 4 15932902 missense probably damaging 1.00
I1329:Decr1 UTSW 4 15930976 nonsense probably null
R0472:Decr1 UTSW 4 15919849 missense probably damaging 1.00
R1295:Decr1 UTSW 4 15919207 missense possibly damaging 0.93
R1898:Decr1 UTSW 4 15929801 missense probably damaging 1.00
R1955:Decr1 UTSW 4 15924256 missense probably benign 0.09
R3160:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R3162:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R3162:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R4545:Decr1 UTSW 4 15930979 missense probably damaging 1.00
R4962:Decr1 UTSW 4 15930976 nonsense probably null
R5188:Decr1 UTSW 4 15924270 missense probably damaging 1.00
R5190:Decr1 UTSW 4 15924270 missense probably damaging 1.00
R5215:Decr1 UTSW 4 15929795 missense probably damaging 1.00
R6164:Decr1 UTSW 4 15924347 missense probably benign 0.32
R6253:Decr1 UTSW 4 15931179 missense probably benign 0.00
R6313:Decr1 UTSW 4 15924261 missense probably benign 0.00
R6830:Decr1 UTSW 4 15924355 critical splice acceptor site probably null
R6998:Decr1 UTSW 4 15930960 missense probably damaging 1.00
R7064:Decr1 UTSW 4 15945392
R8052:Decr1 UTSW 4 15933019 missense probably benign 0.00
X0026:Decr1 UTSW 4 15919846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGCCCTTCGATTATATCCC -3'
(R):5'- TGTTGGAAAAGAGCATTCTAAGCAG -3'

Sequencing Primer
(F):5'- CACTCCTCCTTGGTGACCTGATG -3'
(R):5'- ACTCACTTTGTAGACCAGGCTGG -3'
Posted On2016-10-24