Incidental Mutation 'R5556:Disp3'
ID435378
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Namedispatched RND transporter family member 3
SynonymsPtchd2, G630052C06Rik
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score130
Status Not validated
Chromosome4
Chromosomal Location148240264-148287965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 148258157 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 612 (G612D)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
Predicted Effect probably benign
Transcript: ENSMUST00000047720
AA Change: G612D

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: G612D

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143851
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148241534 missense probably benign 0.10
IGL01065:Disp3 APN 4 148261183 missense probably damaging 1.00
IGL01800:Disp3 APN 4 148249801 nonsense probably null
IGL01947:Disp3 APN 4 148260519 missense probably damaging 1.00
IGL02510:Disp3 APN 4 148252701 missense probably benign 0.00
IGL02573:Disp3 APN 4 148271449 missense probably damaging 1.00
IGL02728:Disp3 APN 4 148272038 missense probably damaging 1.00
IGL02931:Disp3 APN 4 148249201 missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0257:Disp3 UTSW 4 148250754 missense possibly damaging 0.87
R0409:Disp3 UTSW 4 148271959 missense probably damaging 1.00
R0557:Disp3 UTSW 4 148241404 missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148241590 missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148249825 missense probably benign 0.00
R1526:Disp3 UTSW 4 148259916 missense probably benign 0.00
R1791:Disp3 UTSW 4 148241518 missense probably damaging 1.00
R1856:Disp3 UTSW 4 148271632 missense probably damaging 1.00
R1987:Disp3 UTSW 4 148258753 missense probably damaging 0.97
R2030:Disp3 UTSW 4 148259966 missense probably damaging 1.00
R2271:Disp3 UTSW 4 148271602 missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148258795 missense probably damaging 1.00
R2566:Disp3 UTSW 4 148241423 missense probably damaging 1.00
R3731:Disp3 UTSW 4 148252827 missense probably benign 0.03
R4359:Disp3 UTSW 4 148271932 missense probably benign 0.03
R4762:Disp3 UTSW 4 148272118 missense probably damaging 1.00
R4950:Disp3 UTSW 4 148258126 missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148244216 missense possibly damaging 0.79
R5218:Disp3 UTSW 4 148242876 missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148258097 missense probably benign 0.14
R5857:Disp3 UTSW 4 148249183 missense probably benign 0.01
R5933:Disp3 UTSW 4 148241313 nonsense probably null
R5994:Disp3 UTSW 4 148254284 missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148254308 missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148259930 missense probably benign 0.09
R7211:Disp3 UTSW 4 148241522 missense probably damaging 0.98
R7470:Disp3 UTSW 4 148261070 missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148242866 missense probably damaging 0.99
R8093:Disp3 UTSW 4 148270516 missense possibly damaging 0.93
R8357:Disp3 UTSW 4 148261115 missense possibly damaging 0.86
R8457:Disp3 UTSW 4 148261115 missense possibly damaging 0.86
R8506:Disp3 UTSW 4 148241570 missense possibly damaging 0.77
Z1088:Disp3 UTSW 4 148271743 missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148250957 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148249746 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148249847 missense probably benign 0.01
Z1177:Disp3 UTSW 4 148250714 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148270567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCCACATGCTAGGTG -3'
(R):5'- CTCATCATAGTCACTGGTGCC -3'

Sequencing Primer
(F):5'- ACATGCTAGGTGAGGGCCTC -3'
(R):5'- ACTGGTGCCTCTCCTGCAAG -3'
Posted On2016-10-24