Mutagenetix > Incidental Mutation

Incidental Mutation 'R5556:Disp3'

435378

Institutional Source

Beutler Lab

Gene Symbol

Disp3

Ensembl Gene

ENSMUSG00000041544

Gene Name

dispatched RND transporter family member 3

Synonyms

Ptchd2, G630052C06Rik

MMRRC Submission

043113-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5556 (G1)

Quality Score

130

Status

Not validated

Chromosome

Chromosomal Location

148240264-148287965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 148258157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 612 (G612D)

Ref Sequence

ENSEMBL: ENSMUSP00000038490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047720]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000047720
AA Change: G612D

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: G612D

Domain	Start	End	E-Value	Type
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	159	171	N/A	INTRINSIC
low complexity region	179	195	N/A	INTRINSIC
Pfam:Patched	362	735	2.2e-21	PFAM
Pfam:MMPL	366	590	3.1e-14	PFAM
Pfam:Sterol-sensing	435	588	1.1e-17	PFAM
Pfam:Patched	1121	1301	1.6e-7	PFAM
transmembrane domain	1314	1333	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143851

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,693,167	Q456K	probably benign	Het
4933427D14Rik	T	A	11: 72,175,200		probably null	Het
Abca13	A	T	11: 9,258,546	I240F	possibly damaging	Het
Accs	A	G	2: 93,836,083	Y420H	probably damaging	Het
Aco2	T	C	15: 81,889,319	Y20H	probably damaging	Het
Adck2	T	C	6: 39,583,935	V419A	probably benign	Het
Bahd1	T	A	2: 118,916,270	N123K	probably damaging	Het
BC027072	T	C	17: 71,752,425	K86E	possibly damaging	Het
Cast	A	G	13: 74,695,889		probably null	Het
Cd164l2	T	A	4: 133,223,705	V157E	probably damaging	Het
Cdk11b	C	T	4: 155,634,147	Q185*	probably null	Het
Ces2g	T	C	8: 104,967,442	F470S	probably benign	Het
Cherp	C	G	8: 72,467,980	Q313H	probably damaging	Het
Chrna4	A	G	2: 181,033,980	V110A	possibly damaging	Het
Cndp2	A	G	18: 84,672,124	V231A	probably benign	Het
Cst7	A	T	2: 150,570,568	H17L	probably benign	Het
Decr1	C	T	4: 15,919,244	D300N	probably damaging	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dgkb	T	G	12: 38,127,364	V230G	probably damaging	Het
Dis3l2	T	C	1: 86,973,404	V439A	possibly damaging	Het
Dock7	T	C	4: 98,944,735	T1962A	probably damaging	Het
Fam189a1	A	G	7: 64,856,209	F96S	probably damaging	Het
Fibp	T	A	19: 5,464,199	V304E	possibly damaging	Het
Flt3	T	A	5: 147,332,997		probably null	Het
Kifc3	G	A	8: 95,108,459	Q233*	probably null	Het
Klhl42	C	A	6: 147,108,112	S483Y	probably benign	Het
Map3k19	G	A	1: 127,834,547	R276*	probably null	Het
Mecom	A	G	3: 30,238,100	S87P	probably damaging	Het
Med13	A	G	11: 86,327,838	V416A	probably benign	Het
Mepe	G	A	5: 104,338,212	G406D	probably damaging	Het
Met	T	G	6: 17,534,176	L673V	probably benign	Het
Mlh3	A	T	12: 85,268,493	Y306*	probably null	Het
Nrxn2	C	A	19: 6,490,091	A814E	probably damaging	Het
Nsmaf	C	T	4: 6,398,621	V828I	probably benign	Het
Olfr137	T	A	17: 38,305,073	K129N	possibly damaging	Het
Olfr824	A	T	10: 130,126,859	L66H	probably damaging	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pcdhb6	T	A	18: 37,334,389	L121Q	probably damaging	Het
Plekha7	G	A	7: 116,164,149	T406I	probably benign	Het
Prtg	T	C	9: 72,851,704	S447P	probably damaging	Het
Ptprr	A	G	10: 116,251,149	Y267C	probably damaging	Het
Rbpjl	A	G	2: 164,408,062	T134A	probably benign	Het
Rpe	C	A	1: 66,706,466	T55N	probably damaging	Het
Scn1a	T	C	2: 66,324,797	D606G	probably benign	Het
Setd5	T	A	6: 113,147,502	N1105K	probably benign	Het
Sh3d21	T	C	4: 126,162,236	N126D	possibly damaging	Het
Shank1	A	G	7: 44,344,315		probably benign	Het
Srgap3	T	A	6: 112,739,078	D627V	probably damaging	Het
Tacc2	T	A	7: 130,674,606	S1796T	probably damaging	Het
Tcrg-C4	A	T	13: 19,352,307	R178S	unknown	Het
Tmco3	G	A	8: 13,294,870	V217I	probably damaging	Het
Tspan10	A	T	11: 120,444,715	Y217F	possibly damaging	Het
Usp3	G	A	9: 66,544,021	T153M	possibly damaging	Het
Xdh	G	T	17: 73,897,764	T1067K	probably benign	Het
Zfp334	T	C	2: 165,380,584	D513G	probably benign	Het

Other mutations in Disp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Disp3	APN	4	148241534	missense	probably benign	0.10
IGL01065:Disp3	APN	4	148261183	missense	probably damaging	1.00
IGL01800:Disp3	APN	4	148249801	nonsense	probably null
IGL01947:Disp3	APN	4	148260519	missense	probably damaging	1.00
IGL02510:Disp3	APN	4	148252701	missense	probably benign	0.00
IGL02573:Disp3	APN	4	148271449	missense	probably damaging	1.00
IGL02728:Disp3	APN	4	148272038	missense	probably damaging	1.00
IGL02931:Disp3	APN	4	148249201	missense	possibly damaging	0.94
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0257:Disp3	UTSW	4	148250754	missense	possibly damaging	0.87
R0409:Disp3	UTSW	4	148271959	missense	probably damaging	1.00
R0557:Disp3	UTSW	4	148241404	missense	possibly damaging	0.64
R0576:Disp3	UTSW	4	148241590	missense	possibly damaging	0.89
R1495:Disp3	UTSW	4	148249825	missense	probably benign	0.00
R1526:Disp3	UTSW	4	148259916	missense	probably benign	0.00
R1791:Disp3	UTSW	4	148241518	missense	probably damaging	1.00
R1856:Disp3	UTSW	4	148271632	missense	probably damaging	1.00
R1987:Disp3	UTSW	4	148258753	missense	probably damaging	0.97
R2030:Disp3	UTSW	4	148259966	missense	probably damaging	1.00
R2271:Disp3	UTSW	4	148271602	missense	possibly damaging	0.87
R2373:Disp3	UTSW	4	148258795	missense	probably damaging	1.00
R2566:Disp3	UTSW	4	148241423	missense	probably damaging	1.00
R3731:Disp3	UTSW	4	148252827	missense	probably benign	0.03
R4359:Disp3	UTSW	4	148271932	missense	probably benign	0.03
R4762:Disp3	UTSW	4	148272118	missense	probably damaging	1.00
R4950:Disp3	UTSW	4	148258126	missense	possibly damaging	0.94
R4975:Disp3	UTSW	4	148244216	missense	possibly damaging	0.79
R5218:Disp3	UTSW	4	148242876	missense	possibly damaging	0.88
R5523:Disp3	UTSW	4	148258097	missense	probably benign	0.14
R5857:Disp3	UTSW	4	148249183	missense	probably benign	0.01
R5933:Disp3	UTSW	4	148241313	nonsense	probably null
R5994:Disp3	UTSW	4	148254284	missense	possibly damaging	0.94
R6362:Disp3	UTSW	4	148254308	missense	possibly damaging	0.95
R6813:Disp3	UTSW	4	148259930	missense	probably benign	0.09
R7211:Disp3	UTSW	4	148241522	missense	probably damaging	0.98
R7470:Disp3	UTSW	4	148261070	missense	possibly damaging	0.88
R7535:Disp3	UTSW	4	148242866	missense	probably damaging	0.99
R8093:Disp3	UTSW	4	148270516	missense	possibly damaging	0.93
R8357:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8457:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8506:Disp3	UTSW	4	148241570	missense	possibly damaging	0.77
R9182:Disp3	UTSW	4	148270384	missense	probably damaging	1.00
R9219:Disp3	UTSW	4	148249860	missense	possibly damaging	0.74
R9680:Disp3	UTSW	4	148271644	missense	probably damaging	1.00
R9696:Disp3	UTSW	4	148261154	missense	probably damaging	0.97
Z1088:Disp3	UTSW	4	148271743	missense	possibly damaging	0.63
Z1176:Disp3	UTSW	4	148250957	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249746	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249847	missense	probably benign	0.01
Z1177:Disp3	UTSW	4	148250714	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148270567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGCCCACATGCTAGGTG -3'
(R):5'- CTCATCATAGTCACTGGTGCC -3'

Sequencing Primer
(F):5'- ACATGCTAGGTGAGGGCCTC -3'
(R):5'- ACTGGTGCCTCTCCTGCAAG -3'

Posted On

2016-10-24