Incidental Mutation 'R0193:Nup153'
ID43538
Institutional Source Beutler Lab
Gene Symbol Nup153
Ensembl Gene ENSMUSG00000021374
Gene Namenucleoporin 153
SynonymsB130015D15Rik
MMRRC Submission 038452-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R0193 (G1)
Quality Score107
Status Validated (trace)
Chromosome13
Chromosomal Location46679905-46727940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46709654 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 349 (T349I)
Ref Sequence ENSEMBL: ENSMUSP00000021803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021803]
Predicted Effect probably benign
Transcript: ENSMUST00000021803
AA Change: T349I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000021803
Gene: ENSMUSG00000021374
AA Change: T349I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Nup153 114 627 6e-236 PFAM
ZnF_RBZ 656 680 6.56e-6 SMART
ZnF_RBZ 719 743 5.89e-8 SMART
low complexity region 756 775 N/A INTRINSIC
ZnF_RBZ 787 811 7.2e-3 SMART
low complexity region 815 830 N/A INTRINSIC
ZnF_RBZ 844 868 1.64e-6 SMART
low complexity region 898 911 N/A INTRINSIC
low complexity region 1078 1085 N/A INTRINSIC
low complexity region 1183 1207 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1271 1296 N/A INTRINSIC
Pfam:Nup_retrotrp_bd 1372 1462 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183299
Predicted Effect probably benign
Transcript: ENSMUST00000224062
Predicted Effect probably benign
Transcript: ENSMUST00000225894
Meta Mutation Damage Score 0.1411 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes regulate the transport of macromolecules between the nucleus and cytoplasm. They are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. Nucleoporins are glycoproteins found in nuclear pores and contain characteristic pentapeptide XFXFG repeats as well as O-linked N-acetylglucosamine residues oriented towards the cytoplasm. The protein encoded by this gene has three distinct domains: a N-terminal region containing a pore targeting and an RNA-binding domain domain, a central region containing multiple zinc finger motifs, and a C-terminal region containing multiple XFXFG repeats. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,422,359 Q352L probably damaging Het
Adgrb1 T C 15: 74,572,156 S96P probably damaging Het
Akr1c20 A G 13: 4,511,293 probably benign Het
Atp2a3 G T 11: 72,972,220 V99L possibly damaging Het
Atp6v0a1 T A 11: 101,048,482 I691N possibly damaging Het
Atp8b1 C T 18: 64,561,636 R525Q probably benign Het
Aurkb A G 11: 69,048,544 D151G probably damaging Het
Bank1 A T 3: 136,066,518 probably benign Het
Bcl9l T C 9: 44,507,406 L847P probably damaging Het
Bscl2 T A 19: 8,847,429 M292K probably benign Het
Cacna1c C T 6: 118,602,402 probably benign Het
Cadps2 T C 6: 23,599,440 K260R probably benign Het
Cc2d2a T C 5: 43,736,118 S1419P probably damaging Het
Ccdc180 G A 4: 45,914,803 E145K probably benign Het
Ccdc58 T C 16: 36,082,814 S59P probably damaging Het
Ccno C T 13: 112,988,884 probably benign Het
Cd300a A G 11: 114,893,376 D70G probably benign Het
Cenpc1 T C 5: 86,032,403 D670G probably benign Het
Cenpl A G 1: 161,085,988 I323V probably damaging Het
Cfap44 A G 16: 44,449,210 probably null Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clcnkb T C 4: 141,412,316 E125G possibly damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Coro7 G A 16: 4,627,504 probably benign Het
Dchs1 C T 7: 105,764,983 R875H probably benign Het
Eif3j1 A C 2: 122,052,027 M239L probably benign Het
Eif4g3 G T 4: 138,146,376 probably benign Het
Erbb4 T C 1: 68,043,960 probably benign Het
Erlin2 T G 8: 27,031,764 V164G possibly damaging Het
Fbxo43 G T 15: 36,161,883 Q393K probably benign Het
Fcgr4 A T 1: 171,025,760 N178I possibly damaging Het
Grid2 A G 6: 64,063,953 N293S possibly damaging Het
H2-M1 C T 17: 36,671,332 V126I probably benign Het
Htr1f T A 16: 64,926,749 Y60F probably damaging Het
Ilf2 A G 3: 90,481,339 probably null Het
Impg2 A T 16: 56,265,049 K931* probably null Het
Ints1 T C 5: 139,751,730 E2176G probably damaging Het
Iqsec2 T C X: 152,223,403 V1319A probably benign Het
Iqsec3 G T 6: 121,410,724 D685E probably damaging Het
Itgbl1 G A 14: 123,846,546 V279I probably benign Het
Kdm4b C T 17: 56,393,952 A541V probably benign Het
Kif14 A T 1: 136,468,438 T161S probably benign Het
Krt86 T C 15: 101,479,363 probably benign Het
Kyat1 C T 2: 30,187,186 probably null Het
Limch1 T C 5: 67,027,539 W791R probably damaging Het
Map3k11 T A 19: 5,695,846 M396K probably damaging Het
Mat2a A G 6: 72,436,195 probably null Het
Mbnl2 A G 14: 120,379,237 I88V possibly damaging Het
Mib2 T C 4: 155,655,673 T708A probably benign Het
Mkks T C 2: 136,877,606 probably null Het
Mtss1 T C 15: 58,944,017 M565V probably damaging Het
Myoc A G 1: 162,649,035 N436S probably damaging Het
Myod1 T A 7: 46,377,112 V147E probably damaging Het
Ngef A G 1: 87,509,334 L144P probably benign Het
Ngrn C T 7: 80,261,930 R92W probably damaging Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr600 G T 7: 103,346,204 S241R possibly damaging Het
Pigl A G 11: 62,503,748 I135M probably damaging Het
Pitpnm3 A G 11: 72,070,492 probably benign Het
Pkhd1 A T 1: 20,358,917 F2420I probably damaging Het
Polr2b C T 5: 77,320,076 T119M probably damaging Het
Prr29 A G 11: 106,376,896 Y130C probably damaging Het
Rab11fip3 T C 17: 25,990,999 I1048V probably damaging Het
Rab12 G A 17: 66,500,362 T124I probably damaging Het
Rab44 A G 17: 29,140,307 S490G probably benign Het
Rasa3 A G 8: 13,570,233 probably null Het
Rhbdl3 C T 11: 80,353,574 S369L possibly damaging Het
Rimbp2 A T 5: 128,788,356 S643T probably benign Het
Rin1 T G 19: 5,052,652 S396R probably damaging Het
Rpusd3 C T 6: 113,419,237 G28S probably damaging Het
Rtl9 T A X: 143,100,278 S229T probably damaging Het
Rufy1 G T 11: 50,389,852 T701N probably benign Het
Scn4a A T 11: 106,320,538 L1551* probably null Het
Sec24b T C 3: 129,988,984 N1119S probably null Het
Serbp1 T A 6: 67,272,884 *75R probably null Het
Setx C T 2: 29,179,673 P2497S probably benign Het
Slc26a11 A T 11: 119,359,314 I132F probably damaging Het
Slc4a1 A G 11: 102,352,684 V707A possibly damaging Het
Slfn1 A G 11: 83,121,843 I262V probably damaging Het
Tmem168 T A 6: 13,583,313 D523V possibly damaging Het
Traf7 G T 17: 24,510,551 Q469K probably benign Het
Trdmt1 C A 2: 13,544,617 V6F probably damaging Het
Tsacc A T 3: 88,287,088 probably benign Het
Vmn2r5 A G 3: 64,491,530 I589T possibly damaging Het
Vmn2r7 T C 3: 64,691,039 D699G probably damaging Het
Vmn2r82 T C 10: 79,381,295 V487A probably damaging Het
Zfp287 A T 11: 62,715,029 S351T probably benign Het
Zfp651 T C 9: 121,767,666 V696A probably damaging Het
Zfp654 T C 16: 64,785,688 H176R possibly damaging Het
Other mutations in Nup153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nup153 APN 13 46681150 unclassified probably benign
IGL01312:Nup153 APN 13 46686824 missense probably benign 0.03
IGL01459:Nup153 APN 13 46712926 missense possibly damaging 0.84
IGL01646:Nup153 APN 13 46684107 missense possibly damaging 0.80
IGL03064:Nup153 APN 13 46693839 missense probably benign
IGL03288:Nup153 APN 13 46705205 missense possibly damaging 0.71
IGL03369:Nup153 APN 13 46700983 splice site probably null
IGL03371:Nup153 APN 13 46683152 missense probably benign 0.34
R0244:Nup153 UTSW 13 46693936 missense probably benign 0.03
R0448:Nup153 UTSW 13 46717181 missense probably benign 0.00
R0943:Nup153 UTSW 13 46696772 splice site probably benign
R1219:Nup153 UTSW 13 46687219 missense probably benign 0.01
R1381:Nup153 UTSW 13 46689181 missense probably damaging 1.00
R1709:Nup153 UTSW 13 46693974 missense probably damaging 1.00
R1727:Nup153 UTSW 13 46693785 missense probably damaging 1.00
R1818:Nup153 UTSW 13 46681637 missense possibly damaging 0.94
R1824:Nup153 UTSW 13 46713747 missense probably damaging 1.00
R1928:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R2108:Nup153 UTSW 13 46693510 critical splice donor site probably null
R2110:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2111:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2173:Nup153 UTSW 13 46701600 splice site probably benign
R2231:Nup153 UTSW 13 46709627 critical splice donor site probably null
R3879:Nup153 UTSW 13 46683960 missense probably damaging 1.00
R4634:Nup153 UTSW 13 46687230 missense possibly damaging 0.49
R4662:Nup153 UTSW 13 46687274 missense possibly damaging 0.68
R4932:Nup153 UTSW 13 46712737 nonsense probably null
R5011:Nup153 UTSW 13 46687403 missense possibly damaging 0.62
R5023:Nup153 UTSW 13 46681109 unclassified probably benign
R5069:Nup153 UTSW 13 46709792 missense probably benign 0.05
R5137:Nup153 UTSW 13 46684153 missense probably damaging 0.99
R5323:Nup153 UTSW 13 46717206 missense probably benign 0.19
R5345:Nup153 UTSW 13 46686865 nonsense probably null
R5536:Nup153 UTSW 13 46683009 missense probably benign 0.01
R5613:Nup153 UTSW 13 46687271 missense possibly damaging 0.64
R5620:Nup153 UTSW 13 46684006 nonsense probably null
R5764:Nup153 UTSW 13 46687327 missense probably damaging 0.97
R5849:Nup153 UTSW 13 46686976 missense probably damaging 0.99
R6454:Nup153 UTSW 13 46709660 splice site probably null
R6701:Nup153 UTSW 13 46687065 missense probably benign 0.00
R6721:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R6737:Nup153 UTSW 13 46689206 missense probably benign 0.08
R6789:Nup153 UTSW 13 46717316 missense probably damaging 1.00
R6820:Nup153 UTSW 13 46709983 missense probably benign 0.09
R6837:Nup153 UTSW 13 46694051 missense probably damaging 1.00
R6913:Nup153 UTSW 13 46699716 missense probably damaging 1.00
R7052:Nup153 UTSW 13 46687473 missense probably benign 0.09
R7091:Nup153 UTSW 13 46683928 missense probably benign
R7357:Nup153 UTSW 13 46717166 missense probably benign 0.32
R7389:Nup153 UTSW 13 46700987 critical splice donor site probably null
R7423:Nup153 UTSW 13 46696644 critical splice donor site probably null
R7453:Nup153 UTSW 13 46681181 missense probably damaging 1.00
R7611:Nup153 UTSW 13 46687322 missense probably benign 0.01
R7876:Nup153 UTSW 13 46681608 missense probably benign
R7909:Nup153 UTSW 13 46693580 missense probably damaging 1.00
R7938:Nup153 UTSW 13 46689379 splice site probably null
R8735:Nup153 UTSW 13 46727551 start gained probably benign
R8804:Nup153 UTSW 13 46687159 missense probably benign 0.04
R8916:Nup153 UTSW 13 46709986 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCAGAAAACACTGAATGTGCTTCC -3'
(R):5'- GCCCTCTTGCGGTAAAGTTTGAAATC -3'

Sequencing Primer
(F):5'- AACACTGAATGTGCTTCCTTTACTG -3'
(R):5'- CTTGCGGTAAAGTTTGAAATCATGAG -3'
Posted On2013-05-24