Incidental Mutation 'R5556:Mepe'
ID435380
Institutional Source Beutler Lab
Gene Symbol Mepe
Ensembl Gene ENSMUSG00000053863
Gene Namematrix extracellular phosphoglycoprotein with ASARM motif (bone)
SynonymsOF45
MMRRC Submission 043113-MU
Accession Numbers

Genbank: NM_053172; MGI: 2137384

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104325329-104338611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104338212 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 406 (G406D)
Ref Sequence ENSEMBL: ENSMUSP00000065200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066207]
Predicted Effect probably damaging
Transcript: ENSMUST00000066207
AA Change: G406D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065200
Gene: ENSMUSG00000053863
AA Change: G406D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Osteoregulin 29 192 4.2e-76 PFAM
low complexity region 257 272 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased amounts of trabecular bone in their skeleton and undergo less age related bone loss. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Mepe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Mepe APN 5 104337977 missense probably damaging 1.00
IGL01896:Mepe APN 5 104338269 missense possibly damaging 0.85
IGL01997:Mepe APN 5 104337600 missense probably damaging 1.00
IGL02311:Mepe APN 5 104337705 missense probably damaging 0.98
IGL02586:Mepe APN 5 104337450 missense probably benign 0.39
F6893:Mepe UTSW 5 104337376 missense possibly damaging 0.87
R1187:Mepe UTSW 5 104338248 missense probably damaging 0.98
R1218:Mepe UTSW 5 104327073 missense probably benign
R1633:Mepe UTSW 5 104337674 missense probably benign 0.25
R2024:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2026:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2027:Mepe UTSW 5 104327091 missense possibly damaging 0.72
R2393:Mepe UTSW 5 104337461 missense possibly damaging 0.95
R2920:Mepe UTSW 5 104338247 missense probably damaging 0.99
R3040:Mepe UTSW 5 104338122 missense probably damaging 0.99
R3716:Mepe UTSW 5 104337428 missense probably benign 0.25
R3973:Mepe UTSW 5 104337078 missense probably benign
R3976:Mepe UTSW 5 104337078 missense probably benign
R4894:Mepe UTSW 5 104325402 missense probably damaging 0.98
R6256:Mepe UTSW 5 104337074 missense probably benign 0.01
R6788:Mepe UTSW 5 104338208 nonsense probably null
R7361:Mepe UTSW 5 104337143 missense probably benign 0.41
R8431:Mepe UTSW 5 104338181 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCAGCAAAGGTAGCTCTAGC -3'
(R):5'- TAGCACAATGTCCTGGAGGG -3'

Sequencing Primer
(F):5'- CAAAGGTAGCTCTAGCAAAGATG -3'
(R):5'- ACCAGGTCTGTTGGCTTGCTC -3'
Posted On2016-10-24