Incidental Mutation 'R5556:Adck2'
List |< first << previous [record 6 of 56] next >> last >|
ID435383
Institutional Source Beutler Lab
Gene Symbol Adck2
Ensembl Gene ENSMUSG00000046947
Gene NameaarF domain containing kinase 2
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39573873-39588769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39583935 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 419 (V419A)
Ref Sequence ENSEMBL: ENSMUSP00000050256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051249] [ENSMUST00000140364] [ENSMUST00000145788]
Predicted Effect probably benign
Transcript: ENSMUST00000051249
AA Change: V419A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000050256
Gene: ENSMUSG00000046947
AA Change: V419A

DomainStartEndE-ValueType
low complexity region 90 124 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134913
Predicted Effect probably benign
Transcript: ENSMUST00000140364
AA Change: V468A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123563
Gene: ENSMUSG00000046947
AA Change: V468A

DomainStartEndE-ValueType
low complexity region 90 124 N/A INTRINSIC
Pfam:ABC1 289 380 5.4e-18 PFAM
low complexity region 551 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145788
AA Change: V155A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144149
Gene: ENSMUSG00000046947
AA Change: V155A

DomainStartEndE-ValueType
Pfam:ABC1 1 67 4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149304
SMART Domains Protein: ENSMUSP00000121590
Gene: ENSMUSG00000046947

DomainStartEndE-ValueType
Pfam:ABC1 1 69 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Adck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Adck2 APN 6 39583920 missense probably benign 0.02
IGL02369:Adck2 APN 6 39574744 missense probably damaging 0.97
IGL02956:Adck2 APN 6 39576502 missense probably benign 0.11
R0240:Adck2 UTSW 6 39583818 missense probably benign 0.10
R0240:Adck2 UTSW 6 39583818 missense probably benign 0.10
R0241:Adck2 UTSW 6 39583818 missense probably benign 0.10
R0241:Adck2 UTSW 6 39583818 missense probably benign 0.10
R1107:Adck2 UTSW 6 39585785 missense possibly damaging 0.91
R1691:Adck2 UTSW 6 39574968 nonsense probably null
R2125:Adck2 UTSW 6 39575142 missense probably benign 0.00
R2206:Adck2 UTSW 6 39583839 missense probably damaging 1.00
R2422:Adck2 UTSW 6 39583998 missense possibly damaging 0.61
R4795:Adck2 UTSW 6 39576393 missense probably benign 0.02
R6402:Adck2 UTSW 6 39586869 missense possibly damaging 0.84
R6824:Adck2 UTSW 6 39575124 missense probably benign 0.00
R6927:Adck2 UTSW 6 39584064 critical splice donor site probably null
R7163:Adck2 UTSW 6 39583863 missense probably damaging 0.99
R8249:Adck2 UTSW 6 39585733 nonsense probably null
R8775:Adck2 UTSW 6 39575208 critical splice donor site probably null
R8775-TAIL:Adck2 UTSW 6 39575208 critical splice donor site probably null
Z1177:Adck2 UTSW 6 39574088 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGGTGTCCCAATTGATG -3'
(R):5'- GGCTTTCACCAGTGACACAG -3'

Sequencing Primer
(F):5'- CCCAATTGATGCTAGGCTGG -3'
(R):5'- CTTTCACCAGTGACACAGGATAAGG -3'
Posted On2016-10-24