Mutagenetix > Incidental Mutations

Incidental Mutation 'R5556:Tacc2'

435392

Institutional Source

Beutler Lab

Gene Symbol

Tacc2

Ensembl Gene

ENSMUSG00000030852

Gene Name

transforming, acidic coiled-coil containing protein 2

Synonyms

MMRRC Submission

043113-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5556 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130577438-130764785 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 130674606 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1796 (S1796T)

Ref Sequence

ENSEMBL: ENSMUSP00000081561 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207549] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000209108]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059145
AA Change: S89T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852
AA Change: S89T

Domain	Start	End	E-Value	Type
low complexity region	87	102	N/A	INTRINSIC
low complexity region	147	173	N/A	INTRINSIC
internal_repeat_1	181	291	2.03e-5	PROSPERO
low complexity region	345	356	N/A	INTRINSIC
internal_repeat_1	483	566	2.03e-5	PROSPERO
low complexity region	571	586	N/A	INTRINSIC
low complexity region	603	614	N/A	INTRINSIC
low complexity region	648	662	N/A	INTRINSIC
coiled coil region	873	900	N/A	INTRINSIC
Pfam:TACC	939	1145	4e-85	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000084513
AA Change: S1796T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: S1796T

Domain	Start	End	E-Value	Type
internal_repeat_1	19	346	3.83e-6	PROSPERO
low complexity region	398	410	N/A	INTRINSIC
low complexity region	413	431	N/A	INTRINSIC
internal_repeat_1	778	1068	3.83e-6	PROSPERO
low complexity region	1397	1415	N/A	INTRINSIC
low complexity region	1723	1739	N/A	INTRINSIC
low complexity region	1794	1809	N/A	INTRINSIC
low complexity region	1854	1880	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2278	2293	N/A	INTRINSIC
low complexity region	2310	2321	N/A	INTRINSIC
low complexity region	2355	2369	N/A	INTRINSIC
coiled coil region	2606	2633	N/A	INTRINSIC
Pfam:TACC	2673	2873	6.1e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207549

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207789
AA Change: S89T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000207918
AA Change: S1830T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208106

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208722
AA Change: S89T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208882

Predicted Effect

probably benign
Transcript: ENSMUST00000209108

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,693,167	Q456K	probably benign	Het
4933427D14Rik	T	A	11: 72,175,200		probably null	Het
Abca13	A	T	11: 9,258,546	I240F	possibly damaging	Het
Accs	A	G	2: 93,836,083	Y420H	probably damaging	Het
Aco2	T	C	15: 81,889,319	Y20H	probably damaging	Het
Adck2	T	C	6: 39,583,935	V419A	probably benign	Het
Bahd1	T	A	2: 118,916,270	N123K	probably damaging	Het
BC027072	T	C	17: 71,752,425	K86E	possibly damaging	Het
Cast	A	G	13: 74,695,889		probably null	Het
Cd164l2	T	A	4: 133,223,705	V157E	probably damaging	Het
Cdk11b	C	T	4: 155,634,147	Q185*	probably null	Het
Ces2g	T	C	8: 104,967,442	F470S	probably benign	Het
Cherp	C	G	8: 72,467,980	Q313H	probably damaging	Het
Chrna4	A	G	2: 181,033,980	V110A	possibly damaging	Het
Cndp2	A	G	18: 84,672,124	V231A	probably benign	Het
Cst7	A	T	2: 150,570,568	H17L	probably benign	Het
Decr1	C	T	4: 15,919,244	D300N	probably damaging	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dgkb	T	G	12: 38,127,364	V230G	probably damaging	Het
Dis3l2	T	C	1: 86,973,404	V439A	possibly damaging	Het
Disp3	C	T	4: 148,258,157	G612D	probably benign	Het
Dock7	T	C	4: 98,944,735	T1962A	probably damaging	Het
Fam189a1	A	G	7: 64,856,209	F96S	probably damaging	Het
Fibp	T	A	19: 5,464,199	V304E	possibly damaging	Het
Flt3	T	A	5: 147,332,997		probably null	Het
Kifc3	G	A	8: 95,108,459	Q233*	probably null	Het
Klhl42	C	A	6: 147,108,112	S483Y	probably benign	Het
Map3k19	G	A	1: 127,834,547	R276*	probably null	Het
Mecom	A	G	3: 30,238,100	S87P	probably damaging	Het
Med13	A	G	11: 86,327,838	V416A	probably benign	Het
Mepe	G	A	5: 104,338,212	G406D	probably damaging	Het
Met	T	G	6: 17,534,176	L673V	probably benign	Het
Mlh3	A	T	12: 85,268,493	Y306*	probably null	Het
Nrxn2	C	A	19: 6,490,091	A814E	probably damaging	Het
Nsmaf	C	T	4: 6,398,621	V828I	probably benign	Het
Olfr137	T	A	17: 38,305,073	K129N	possibly damaging	Het
Olfr824	A	T	10: 130,126,859	L66H	probably damaging	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pcdhb6	T	A	18: 37,334,389	L121Q	probably damaging	Het
Plekha7	G	A	7: 116,164,149	T406I	probably benign	Het
Prtg	T	C	9: 72,851,704	S447P	probably damaging	Het
Ptprr	A	G	10: 116,251,149	Y267C	probably damaging	Het
Rbpjl	A	G	2: 164,408,062	T134A	probably benign	Het
Rpe	C	A	1: 66,706,466	T55N	probably damaging	Het
Scn1a	T	C	2: 66,324,797	D606G	probably benign	Het
Setd5	T	A	6: 113,147,502	N1105K	probably benign	Het
Sh3d21	T	C	4: 126,162,236	N126D	possibly damaging	Het
Shank1	A	G	7: 44,344,315		probably benign	Het
Srgap3	T	A	6: 112,739,078	D627V	probably damaging	Het
Tcrg-C4	A	T	13: 19,352,307	R178S	unknown	Het
Tmco3	G	A	8: 13,294,870	V217I	probably damaging	Het
Tspan10	A	T	11: 120,444,715	Y217F	possibly damaging	Het
Usp3	G	A	9: 66,544,021	T153M	possibly damaging	Het
Xdh	G	T	17: 73,897,764	T1067K	probably benign	Het
Zfp334	T	C	2: 165,380,584	D513G	probably benign	Het

Other mutations in Tacc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Tacc2	APN	7	130759168	missense	probably damaging	1.00
IGL01396:Tacc2	APN	7	130759189	missense	probably damaging	0.98
IGL01621:Tacc2	APN	7	130729768	missense	probably damaging	0.99
IGL02000:Tacc2	APN	7	130729168	splice site	probably null
IGL02075:Tacc2	APN	7	130728852	missense	probably benign	0.03
IGL02201:Tacc2	APN	7	130626212	missense	possibly damaging	0.84
IGL02205:Tacc2	APN	7	130626682	missense	probably damaging	1.00
IGL02399:Tacc2	APN	7	130623399	missense	probably benign	0.15
IGL02456:Tacc2	APN	7	130626261	missense	probably benign	0.35
IGL02559:Tacc2	APN	7	130759267	missense	probably damaging	1.00
IGL02734:Tacc2	APN	7	130626099	missense	probably damaging	0.98
IGL02800:Tacc2	APN	7	130624079	missense	probably benign	0.40
IGL02938:Tacc2	APN	7	130728941	missense	probably damaging	1.00
IGL03031:Tacc2	APN	7	130623855	missense	possibly damaging	0.94
IGL03278:Tacc2	APN	7	130733568	critical splice donor site	probably null
IGL03283:Tacc2	APN	7	130742266	missense	possibly damaging	0.47
IGL03371:Tacc2	APN	7	130626061	missense	possibly damaging	0.90
aces	UTSW	7	130733528	missense	probably damaging	1.00
Jacks	UTSW	7	130625764	missense	probably damaging	0.98
kings	UTSW	7	130623483	missense	probably damaging	0.96
R0002:Tacc2	UTSW	7	130621785	missense	probably damaging	0.99
R0119:Tacc2	UTSW	7	130621875	missense	probably damaging	0.98
R0244:Tacc2	UTSW	7	130751825	splice site	probably benign
R0619:Tacc2	UTSW	7	130716753	missense	probably damaging	1.00
R0624:Tacc2	UTSW	7	130577509	missense	probably damaging	0.99
R0632:Tacc2	UTSW	7	130625595	nonsense	probably null
R1015:Tacc2	UTSW	7	130624065	missense	probably benign
R1081:Tacc2	UTSW	7	130728574	missense	possibly damaging	0.46
R1086:Tacc2	UTSW	7	130626497	missense	possibly damaging	0.94
R1351:Tacc2	UTSW	7	130663003	intron	probably benign
R1538:Tacc2	UTSW	7	130625419	missense	probably benign	0.03
R1743:Tacc2	UTSW	7	130626598	nonsense	probably null
R1771:Tacc2	UTSW	7	130742240	missense	probably damaging	1.00
R1876:Tacc2	UTSW	7	130623745	missense	probably benign	0.38
R1893:Tacc2	UTSW	7	130625325	missense	probably benign	0.01
R1899:Tacc2	UTSW	7	130624202	missense	possibly damaging	0.81
R2005:Tacc2	UTSW	7	130731550	missense	probably damaging	1.00
R2131:Tacc2	UTSW	7	130621857	missense	possibly damaging	0.90
R2338:Tacc2	UTSW	7	130733569	splice site	probably null
R2407:Tacc2	UTSW	7	130622040	missense	possibly damaging	0.65
R3051:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3052:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3053:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3116:Tacc2	UTSW	7	130759249	missense	probably damaging	1.00
R3412:Tacc2	UTSW	7	130734994	missense	probably benign	0.02
R3683:Tacc2	UTSW	7	130625070	missense	probably benign	0.40
R3685:Tacc2	UTSW	7	130625070	missense	probably benign	0.40
R3872:Tacc2	UTSW	7	130622422	missense	probably benign	0.02
R4063:Tacc2	UTSW	7	130729122	missense	probably damaging	0.97
R4410:Tacc2	UTSW	7	130742211	missense	possibly damaging	0.80
R4434:Tacc2	UTSW	7	130623541	missense	probably damaging	0.96
R4438:Tacc2	UTSW	7	130623541	missense	probably damaging	0.96
R4618:Tacc2	UTSW	7	130626216	missense	probably benign	0.10
R4674:Tacc2	UTSW	7	130624861	missense	possibly damaging	0.75
R4742:Tacc2	UTSW	7	130625967	missense	probably benign	0.00
R4934:Tacc2	UTSW	7	130728588	missense	probably damaging	1.00
R4947:Tacc2	UTSW	7	130625899	missense	probably damaging	0.98
R4964:Tacc2	UTSW	7	130728777	missense	probably damaging	1.00
R4966:Tacc2	UTSW	7	130728777	missense	probably damaging	1.00
R4967:Tacc2	UTSW	7	130623948	missense	probably damaging	0.99
R5052:Tacc2	UTSW	7	130735014	missense	probably damaging	1.00
R5276:Tacc2	UTSW	7	130729317	missense	probably damaging	1.00
R5330:Tacc2	UTSW	7	130733528	missense	probably damaging	1.00
R5331:Tacc2	UTSW	7	130733528	missense	probably damaging	1.00
R5372:Tacc2	UTSW	7	130623260	missense	probably benign	0.09
R5645:Tacc2	UTSW	7	130624051	missense	possibly damaging	0.80
R5886:Tacc2	UTSW	7	130729120	missense	probably benign	0.18
R5996:Tacc2	UTSW	7	130623483	missense	probably damaging	0.96
R6074:Tacc2	UTSW	7	130625435	missense	possibly damaging	0.92
R6127:Tacc2	UTSW	7	130626115	missense	possibly damaging	0.92
R6156:Tacc2	UTSW	7	130625764	missense	probably damaging	0.98
R6298:Tacc2	UTSW	7	130626525	missense	probably benign	0.26
R6444:Tacc2	UTSW	7	130623412	missense	possibly damaging	0.46
R6533:Tacc2	UTSW	7	130622837	missense	possibly damaging	0.94
R6724:Tacc2	UTSW	7	130728762	missense	probably damaging	1.00
R7111:Tacc2	UTSW	7	130728888	missense	probably benign	0.16
R7150:Tacc2	UTSW	7	130729077	missense	probably benign
R7290:Tacc2	UTSW	7	130729373	missense	probably benign	0.07
R7404:Tacc2	UTSW	7	130623336	missense	probably benign	0.22
R7460:Tacc2	UTSW	7	130624633	missense	probably benign	0.39
R7651:Tacc2	UTSW	7	130623154	missense	probably benign	0.25
R7666:Tacc2	UTSW	7	130716814	start gained	probably benign
R7695:Tacc2	UTSW	7	130728903	missense	probably benign	0.08
R7766:Tacc2	UTSW	7	130743598	missense	probably damaging	1.00
R7793:Tacc2	UTSW	7	130623113	missense	probably benign	0.34
R7861:Tacc2	UTSW	7	130625431	missense	probably benign	0.00
R8204:Tacc2	UTSW	7	130624429	missense	probably damaging	0.97
R8244:Tacc2	UTSW	7	130728676	missense	probably damaging	1.00
R8245:Tacc2	UTSW	7	130729573	missense	probably damaging	1.00
R8283:Tacc2	UTSW	7	130625304	missense	probably benign	0.02
R8348:Tacc2	UTSW	7	130623289	missense	possibly damaging	0.84
R8369:Tacc2	UTSW	7	130622158	missense	probably damaging	0.98
R8381:Tacc2	UTSW	7	130624242	missense	probably benign	0.00
X0010:Tacc2	UTSW	7	130735057	missense	probably damaging	1.00
Z1176:Tacc2	UTSW	7	130623370	missense	probably benign	0.01
Z1176:Tacc2	UTSW	7	130624270	missense	possibly damaging	0.59
Z1176:Tacc2	UTSW	7	130744597	missense	probably damaging	1.00
Z1177:Tacc2	UTSW	7	130624980	missense	probably damaging	1.00
Z1177:Tacc2	UTSW	7	130625774	missense	probably damaging	0.99
Z1177:Tacc2	UTSW	7	130734949	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCCTCTACCATGTGTAAGTCG -3'
(R):5'- TGCTGGCACCATCCTAAAC -3'

Sequencing Primer
(F):5'- CTCTACCATGTGTAAGTCGAGGGAG -3'
(R):5'- GTGAGAGAGACCACCCAGC -3'

Posted On

2016-10-24