Incidental Mutation 'R5556:Tmco3'
ID435393
Institutional Source Beutler Lab
Gene Symbol Tmco3
Ensembl Gene ENSMUSG00000038497
Gene Nametransmembrane and coiled-coil domains 3
SynonymsB230339H12Rik
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13288190-13322924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13294870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 217 (V217I)
Ref Sequence ENSEMBL: ENSMUSP00000040347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045229]
Predicted Effect probably damaging
Transcript: ENSMUST00000045229
AA Change: V217I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040347
Gene: ENSMUSG00000038497
AA Change: V217I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
coiled coil region 124 204 N/A INTRINSIC
Pfam:Na_H_Exchanger 274 662 9.2e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211645
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Tmco3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Tmco3 APN 8 13292825 missense probably damaging 1.00
IGL01139:Tmco3 APN 8 13319887 missense possibly damaging 0.92
IGL02116:Tmco3 APN 8 13292706 unclassified probably benign
IGL03114:Tmco3 APN 8 13298205 splice site probably benign
Ganado UTSW 8 13292077 unclassified probably null
R0244:Tmco3 UTSW 8 13292037 missense probably damaging 1.00
R0385:Tmco3 UTSW 8 13296027 missense probably damaging 1.00
R0711:Tmco3 UTSW 8 13292039 missense probably damaging 0.96
R1594:Tmco3 UTSW 8 13292052 missense probably damaging 0.98
R1727:Tmco3 UTSW 8 13318866 missense possibly damaging 0.52
R1752:Tmco3 UTSW 8 13291741 missense probably benign
R2375:Tmco3 UTSW 8 13292059 missense possibly damaging 0.72
R2850:Tmco3 UTSW 8 13295024 missense probably benign 0.00
R3843:Tmco3 UTSW 8 13296114 splice site probably benign
R4003:Tmco3 UTSW 8 13291959 missense probably damaging 0.96
R4059:Tmco3 UTSW 8 13320848 missense probably benign 0.27
R5071:Tmco3 UTSW 8 13292860 nonsense probably null
R5072:Tmco3 UTSW 8 13292860 nonsense probably null
R5456:Tmco3 UTSW 8 13319815 missense probably damaging 0.96
R5826:Tmco3 UTSW 8 13310314 missense probably damaging 0.99
R6200:Tmco3 UTSW 8 13292077 unclassified probably null
R6586:Tmco3 UTSW 8 13320894 utr 3 prime probably benign
R6858:Tmco3 UTSW 8 13313924 missense probably damaging 1.00
R6867:Tmco3 UTSW 8 13313927 missense probably damaging 1.00
R6944:Tmco3 UTSW 8 13303729 missense probably damaging 1.00
R7082:Tmco3 UTSW 8 13320847 nonsense probably null
R7192:Tmco3 UTSW 8 13319605 intron probably null
R7283:Tmco3 UTSW 8 13319605 intron probably null
R7285:Tmco3 UTSW 8 13319605 intron probably null
R7287:Tmco3 UTSW 8 13319605 intron probably null
R7314:Tmco3 UTSW 8 13319605 intron probably null
R7442:Tmco3 UTSW 8 13320781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGACTTCGCTTTCCTGATC -3'
(R):5'- GGCCATGGCTTGCCTTTATG -3'

Sequencing Primer
(F):5'- TGGAATTCACCCTGTAGACCAG -3'
(R):5'- CCATGGCTTGCCTTTATGAAGTG -3'
Posted On2016-10-24