Incidental Mutation 'R5556:Cherp'
List |< first << previous [record 13 of 56] next >> last >|
ID435394
Institutional Source Beutler Lab
Gene Symbol Cherp
Ensembl Gene ENSMUSG00000052488
Gene Namecalcium homeostasis endoplasmic reticulum protein
SynonymsDAN16, SCAF6, D8Wsu96e, 5730408I11Rik
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5556 (G1)
Quality Score221
Status Not validated
Chromosome8
Chromosomal Location72460489-72475226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 72467980 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 313 (Q313H)
Ref Sequence ENSEMBL: ENSMUSP00000148273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079510] [ENSMUST00000212991]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079510
AA Change: Q324H

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078469
Gene: ENSMUSG00000052488
AA Change: Q324H

DomainStartEndE-ValueType
SWAP 13 65 9.76e-24 SMART
low complexity region 78 100 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
RPR 156 286 5.32e-2 SMART
coiled coil region 310 334 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
low complexity region 439 463 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 526 560 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
low complexity region 743 829 N/A INTRINSIC
G_patch 850 900 9.8e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212870
Predicted Effect probably damaging
Transcript: ENSMUST00000212991
AA Change: Q313H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Cherp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cherp APN 8 72468246 missense probably damaging 0.97
IGL00955:Cherp APN 8 72470194 missense probably damaging 0.99
R0452:Cherp UTSW 8 72461522 unclassified probably benign
R0479:Cherp UTSW 8 72463147 missense possibly damaging 0.66
R0594:Cherp UTSW 8 72462402 critical splice donor site probably null
R1734:Cherp UTSW 8 72470088 critical splice donor site probably null
R1781:Cherp UTSW 8 72467771 missense probably damaging 1.00
R1793:Cherp UTSW 8 72463150 missense probably benign 0.12
R2012:Cherp UTSW 8 72474769 missense probably damaging 0.98
R2845:Cherp UTSW 8 72466403 missense probably damaging 0.99
R3612:Cherp UTSW 8 72461996 unclassified probably benign
R3693:Cherp UTSW 8 72467911 small deletion probably benign
R3899:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3900:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3970:Cherp UTSW 8 72469951 missense possibly damaging 0.60
R4915:Cherp UTSW 8 72468397 missense probably damaging 1.00
R5512:Cherp UTSW 8 72463266 missense possibly damaging 0.66
R5739:Cherp UTSW 8 72467815 small deletion probably benign
R5768:Cherp UTSW 8 72463113 missense probably damaging 0.98
R5824:Cherp UTSW 8 72462258 unclassified probably benign
R5963:Cherp UTSW 8 72461535 unclassified probably benign
R6255:Cherp UTSW 8 72470881 missense probably damaging 0.99
R7145:Cherp UTSW 8 72468386 missense
R7538:Cherp UTSW 8 72462419 missense
R7578:Cherp UTSW 8 72464258 missense
R8329:Cherp UTSW 8 72462008 missense
RF001:Cherp UTSW 8 72462049 frame shift probably null
RF007:Cherp UTSW 8 72462059 small deletion probably benign
RF036:Cherp UTSW 8 72462044 frame shift probably null
RF036:Cherp UTSW 8 72462047 frame shift probably null
RF059:Cherp UTSW 8 72462055 frame shift probably null
T0722:Cherp UTSW 8 72462034 small deletion probably benign
T0975:Cherp UTSW 8 72462034 small deletion probably benign
Z1176:Cherp UTSW 8 72470953 missense
Z1177:Cherp UTSW 8 72462916 missense
Z1177:Cherp UTSW 8 72475135 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACCTCATACCTGGCTGGGTAG -3'
(R):5'- TCAGGACGTTTAAAACTGCCC -3'

Sequencing Primer
(F):5'- CATACCTGGCTGGGTAGTTGGTG -3'
(R):5'- GGACGTTTAAAACTGCCCACTATTG -3'
Posted On2016-10-24