Incidental Mutation 'R5556:Kifc3'
ID435395
Institutional Source Beutler Lab
Gene Symbol Kifc3
Ensembl Gene ENSMUSG00000031788
Gene Namekinesin family member C3
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score208
Status Not validated
Chromosome8
Chromosomal Location95099828-95202812 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 95108459 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 233 (Q233*)
Ref Sequence ENSEMBL: ENSMUSP00000148425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212424] [ENSMUST00000212787] [ENSMUST00000213004]
Predicted Effect probably null
Transcript: ENSMUST00000034240
AA Change: Q370*
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788
AA Change: Q370*

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169353
AA Change: Q255*
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788
AA Change: Q255*

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169748
AA Change: Q334*
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788
AA Change: Q334*

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211854
Predicted Effect probably benign
Transcript: ENSMUST00000212424
Predicted Effect probably benign
Transcript: ENSMUST00000212787
Predicted Effect probably null
Transcript: ENSMUST00000213004
AA Change: Q233*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Kifc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Kifc3 APN 8 95138016 missense probably damaging 1.00
IGL01904:Kifc3 APN 8 95137957 missense possibly damaging 0.81
IGL02019:Kifc3 APN 8 95107540 splice site probably benign
IGL02090:Kifc3 APN 8 95102480 missense probably damaging 1.00
IGL02355:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02362:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02620:Kifc3 APN 8 95109954 missense probably damaging 0.98
IGL02720:Kifc3 APN 8 95108365 missense probably benign 0.00
IGL03030:Kifc3 APN 8 95102412 missense probably damaging 1.00
IGL03327:Kifc3 APN 8 95108432 missense probably damaging 1.00
IGL03390:Kifc3 APN 8 95108613 missense probably damaging 1.00
R0233:Kifc3 UTSW 8 95101472 unclassified probably null
R0281:Kifc3 UTSW 8 95103460 missense probably damaging 1.00
R0302:Kifc3 UTSW 8 95103470 missense possibly damaging 0.50
R0619:Kifc3 UTSW 8 95102665 missense probably benign 0.13
R0731:Kifc3 UTSW 8 95105733 missense probably damaging 1.00
R1017:Kifc3 UTSW 8 95105785 missense probably damaging 0.99
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1257:Kifc3 UTSW 8 95105772 missense probably damaging 0.98
R1472:Kifc3 UTSW 8 95137913 critical splice donor site probably null
R1480:Kifc3 UTSW 8 95109887 missense probably damaging 1.00
R1553:Kifc3 UTSW 8 95106542 missense possibly damaging 0.67
R2071:Kifc3 UTSW 8 95108353 critical splice donor site probably null
R2115:Kifc3 UTSW 8 95108713 missense probably damaging 1.00
R3703:Kifc3 UTSW 8 95104028 splice site probably benign
R3704:Kifc3 UTSW 8 95104028 splice site probably benign
R3705:Kifc3 UTSW 8 95104028 splice site probably benign
R4223:Kifc3 UTSW 8 95109982 missense probably damaging 0.96
R4463:Kifc3 UTSW 8 95102116 missense probably damaging 1.00
R4508:Kifc3 UTSW 8 95107420 splice site probably null
R4980:Kifc3 UTSW 8 95126549 missense probably benign
R5032:Kifc3 UTSW 8 95102726 missense probably damaging 1.00
R5068:Kifc3 UTSW 8 95110216 missense possibly damaging 0.54
R5421:Kifc3 UTSW 8 95109845 missense probably damaging 0.99
R6845:Kifc3 UTSW 8 95108679 missense probably benign 0.28
R7136:Kifc3 UTSW 8 95103449 missense probably benign 0.10
R7196:Kifc3 UTSW 8 95106611 missense probably benign 0.02
R7404:Kifc3 UTSW 8 95103464 missense probably benign 0.02
R7441:Kifc3 UTSW 8 95137987 missense probably benign 0.00
R7784:Kifc3 UTSW 8 95110692 critical splice donor site probably null
R7861:Kifc3 UTSW 8 95107537 critical splice acceptor site probably null
R7944:Kifc3 UTSW 8 95107537 critical splice acceptor site probably null
X0023:Kifc3 UTSW 8 95109298 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACAGATGGGAGCTCATG -3'
(R):5'- TGGAGGAGATGCAGTCCTTG -3'

Sequencing Primer
(F):5'- GCTCATGAAAGGACAGTGTGTG -3'
(R):5'- TAAGAACCGGGCCATTGAG -3'
Posted On2016-10-24