Incidental Mutation 'R5556:Panx1'
ID435397
Institutional Source Beutler Lab
Gene Symbol Panx1
Ensembl Gene ENSMUSG00000031934
Gene Namepannexin 1
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15002128-15045478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15007633 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 310 (I310T)
Ref Sequence ENSEMBL: ENSMUSP00000126405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056755] [ENSMUST00000164273] [ENSMUST00000169288]
Predicted Effect probably benign
Transcript: ENSMUST00000056755
SMART Domains Protein: ENSMUSP00000053557
Gene: ENSMUSG00000031934

DomainStartEndE-ValueType
Pfam:Innexin 31 102 1.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164273
AA Change: I310T

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126405
Gene: ENSMUSG00000031934
AA Change: I310T

DomainStartEndE-ValueType
Pfam:Innexin 33 256 2.1e-16 PFAM
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166933
Predicted Effect probably benign
Transcript: ENSMUST00000169288
Meta Mutation Damage Score 0.2252 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage recruitment, YO-PRO-1 dye uptake, ATP release by apoptotic thymocytes, hippocampal neurons, and astrocytes. Mice homozygous for a different knock-out allele exhibit protection from I/R-induced retinal ganglion cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Panx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Panx1 APN 9 15007844 missense probably damaging 0.97
IGL01364:Panx1 APN 9 15021465 missense probably damaging 1.00
IGL02831:Panx1 APN 9 15007648 missense probably damaging 1.00
IGL02861:Panx1 APN 9 15007805 missense probably benign
cathedral UTSW 9 15007633 missense possibly damaging 0.53
elephant UTSW 9 15010217 missense probably damaging 1.00
notre_dame UTSW 9 15010217 missense probably damaging 1.00
R0422:Panx1 UTSW 9 15007816 nonsense probably null
R0602:Panx1 UTSW 9 15010204 missense probably damaging 1.00
R1509:Panx1 UTSW 9 15010045 missense possibly damaging 0.53
R1681:Panx1 UTSW 9 15007783 missense probably benign 0.13
R1862:Panx1 UTSW 9 15007428 missense probably damaging 1.00
R1895:Panx1 UTSW 9 15007526 missense probably benign 0.13
R1937:Panx1 UTSW 9 15007684 missense possibly damaging 0.68
R1946:Panx1 UTSW 9 15007526 missense probably benign 0.13
R2447:Panx1 UTSW 9 15044889 missense probably damaging 0.99
R3732:Panx1 UTSW 9 15006171 unclassified probably benign
R3732:Panx1 UTSW 9 15006171 unclassified probably benign
R3733:Panx1 UTSW 9 15006171 unclassified probably benign
R3734:Panx1 UTSW 9 15006171 unclassified probably benign
R3958:Panx1 UTSW 9 15006171 unclassified probably benign
R3960:Panx1 UTSW 9 15006171 unclassified probably benign
R4744:Panx1 UTSW 9 15010298 intron probably benign
R4990:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R5272:Panx1 UTSW 9 15044856 critical splice donor site probably null
R5935:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R6126:Panx1 UTSW 9 15007790 missense probably benign 0.38
R6683:Panx1 UTSW 9 15008011 missense probably benign 0.41
R6743:Panx1 UTSW 9 15007633 missense possibly damaging 0.53
R6873:Panx1 UTSW 9 15010217 missense probably damaging 1.00
R7944:Panx1 UTSW 9 15007829 missense probably damaging 1.00
R8061:Panx1 UTSW 9 15045001 missense possibly damaging 0.58
Z1177:Panx1 UTSW 9 15007814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTAATCATGCCCAGGTTTGTC -3'
(R):5'- ACGAGTTTCTGTGCAGCATC -3'

Sequencing Primer
(F):5'- TAATCATGCCCAGGTTTGTCAGGAG -3'
(R):5'- TTCTGTGCAGCATCAAATCAGGC -3'
Posted On2016-10-24