Incidental Mutation 'R5556:Usp3'
ID435398
Institutional Source Beutler Lab
Gene Symbol Usp3
Ensembl Gene ENSMUSG00000032376
Gene Nameubiquitin specific peptidase 3
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location66514637-66593142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66544021 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 153 (T153M)
Ref Sequence ENSEMBL: ENSMUSP00000096213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098613] [ENSMUST00000127569] [ENSMUST00000139547] [ENSMUST00000174387]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034940
Predicted Effect possibly damaging
Transcript: ENSMUST00000098613
AA Change: T153M

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096213
Gene: ENSMUSG00000032376
AA Change: T153M

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 6.6e-23 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 188 1.1e-8 PFAM
Pfam:UCH 178 470 4.2e-54 PFAM
Pfam:UCH_1 193 452 3.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124694
Predicted Effect possibly damaging
Transcript: ENSMUST00000127569
AA Change: T153M

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122199
Gene: ENSMUSG00000032376
AA Change: T153M

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 1.2e-22 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 508 2.5e-61 PFAM
Pfam:UCH_1 206 490 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139952
Predicted Effect possibly damaging
Transcript: ENSMUST00000174387
AA Change: T109M

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134472
Gene: ENSMUSG00000032376
AA Change: T109M

DomainStartEndE-ValueType
Pfam:zf-UBP 29 142 1.6e-7 PFAM
Pfam:UCH 114 464 9.9e-69 PFAM
Pfam:UCH_1 115 446 2e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a chromatin-associated histone 2A and 2B deubiquitinating enzyme that negatively regulates the DNA damage response. Mice deficient for this enzyme have reduced hematopoietic stem cell reserves, demonstrating a requirement in hematopoietic stem cell homeostasis. In addition, knock down of protein levels results in spontaneous tumor development and shortened lifespan, consistent with a function in preserving chromosomal integrity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Usp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Usp3 APN 9 66562552 critical splice donor site probably null
IGL02951:Usp3 APN 9 66542550 nonsense probably null
IGL03283:Usp3 APN 9 66562549 splice site probably null
R0148:Usp3 UTSW 9 66540167 missense possibly damaging 0.80
R0152:Usp3 UTSW 9 66540150 missense probably damaging 0.97
R0184:Usp3 UTSW 9 66562581 missense probably damaging 0.99
R0628:Usp3 UTSW 9 66518444 missense probably benign 0.05
R1036:Usp3 UTSW 9 66530231 splice site probably benign
R2251:Usp3 UTSW 9 66562578 missense probably damaging 0.99
R2437:Usp3 UTSW 9 66545742 critical splice donor site probably null
R3957:Usp3 UTSW 9 66562591 missense probably benign 0.04
R4320:Usp3 UTSW 9 66530248 missense possibly damaging 0.80
R4439:Usp3 UTSW 9 66518494 missense probably benign 0.00
R4562:Usp3 UTSW 9 66520765 intron probably benign
R4659:Usp3 UTSW 9 66527070 intron probably null
R4742:Usp3 UTSW 9 66520677 missense probably damaging 1.00
R5134:Usp3 UTSW 9 66542532 missense possibly damaging 0.82
R5242:Usp3 UTSW 9 66527150 missense probably damaging 1.00
R6949:Usp3 UTSW 9 66520690 missense probably benign 0.37
R7440:Usp3 UTSW 9 66530255 missense probably benign 0.03
R7452:Usp3 UTSW 9 66566898 missense probably benign 0.11
R7547:Usp3 UTSW 9 66542624 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCTCTAATGAGGACAAAGCACC -3'
(R):5'- TTCTCACAGTCACTAAAATATCCGTGC -3'

Sequencing Primer
(F):5'- CACCGAAGCTAGAGTTAGAGGC -3'
(R):5'- TGCCCTCACATAGCCTAGAAAATTTG -3'
Posted On2016-10-24