Mutagenetix > Incidental Mutations

Incidental Mutation 'R5556:Prtg'

435399

Institutional Source

Beutler Lab

Gene Symbol

Prtg

Ensembl Gene

ENSMUSG00000036030

Gene Name

protogenin

Synonyms

Igdcc5, A230098A12Rik

MMRRC Submission

043113-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.798) question?

Stock #

R5556 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72806874-72917291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72851704 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 447 (S447P)

Ref Sequence

ENSEMBL: ENSMUSP00000055815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055535]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055535
AA Change: S447P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030
AA Change: S447P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc2	45	114	1.7e-8	SMART
IGc2	141	206	8.5e-12	SMART
IGc2	241	305	6.9e-12	SMART
IGc2	333	396	9.4e-10	SMART
FN3	413	496	8.9e-11	SMART
FN3	511	594	1.3e-10	SMART
FN3	613	693	1.5e-5	SMART
FN3	715	798	3e-10	SMART
FN3	814	898	4.4e-12	SMART
transmembrane domain	943	965	N/A	INTRINSIC
low complexity region	966	976	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,693,167	Q456K	probably benign	Het
4933427D14Rik	T	A	11: 72,175,200		probably null	Het
Abca13	A	T	11: 9,258,546	I240F	possibly damaging	Het
Accs	A	G	2: 93,836,083	Y420H	probably damaging	Het
Aco2	T	C	15: 81,889,319	Y20H	probably damaging	Het
Adck2	T	C	6: 39,583,935	V419A	probably benign	Het
Bahd1	T	A	2: 118,916,270	N123K	probably damaging	Het
BC027072	T	C	17: 71,752,425	K86E	possibly damaging	Het
Cast	A	G	13: 74,695,889		probably null	Het
Cd164l2	T	A	4: 133,223,705	V157E	probably damaging	Het
Cdk11b	C	T	4: 155,634,147	Q185*	probably null	Het
Ces2g	T	C	8: 104,967,442	F470S	probably benign	Het
Cherp	C	G	8: 72,467,980	Q313H	probably damaging	Het
Chrna4	A	G	2: 181,033,980	V110A	possibly damaging	Het
Cndp2	A	G	18: 84,672,124	V231A	probably benign	Het
Cst7	A	T	2: 150,570,568	H17L	probably benign	Het
Decr1	C	T	4: 15,919,244	D300N	probably damaging	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dgkb	T	G	12: 38,127,364	V230G	probably damaging	Het
Dis3l2	T	C	1: 86,973,404	V439A	possibly damaging	Het
Disp3	C	T	4: 148,258,157	G612D	probably benign	Het
Dock7	T	C	4: 98,944,735	T1962A	probably damaging	Het
Fam189a1	A	G	7: 64,856,209	F96S	probably damaging	Het
Fibp	T	A	19: 5,464,199	V304E	possibly damaging	Het
Flt3	T	A	5: 147,332,997		probably null	Het
Kifc3	G	A	8: 95,108,459	Q233*	probably null	Het
Klhl42	C	A	6: 147,108,112	S483Y	probably benign	Het
Map3k19	G	A	1: 127,834,547	R276*	probably null	Het
Mecom	A	G	3: 30,238,100	S87P	probably damaging	Het
Med13	A	G	11: 86,327,838	V416A	probably benign	Het
Mepe	G	A	5: 104,338,212	G406D	probably damaging	Het
Met	T	G	6: 17,534,176	L673V	probably benign	Het
Mlh3	A	T	12: 85,268,493	Y306*	probably null	Het
Nrxn2	C	A	19: 6,490,091	A814E	probably damaging	Het
Nsmaf	C	T	4: 6,398,621	V828I	probably benign	Het
Olfr137	T	A	17: 38,305,073	K129N	possibly damaging	Het
Olfr824	A	T	10: 130,126,859	L66H	probably damaging	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pcdhb6	T	A	18: 37,334,389	L121Q	probably damaging	Het
Plekha7	G	A	7: 116,164,149	T406I	probably benign	Het
Ptprr	A	G	10: 116,251,149	Y267C	probably damaging	Het
Rbpjl	A	G	2: 164,408,062	T134A	probably benign	Het
Rpe	C	A	1: 66,706,466	T55N	probably damaging	Het
Scn1a	T	C	2: 66,324,797	D606G	probably benign	Het
Setd5	T	A	6: 113,147,502	N1105K	probably benign	Het
Sh3d21	T	C	4: 126,162,236	N126D	possibly damaging	Het
Shank1	A	G	7: 44,344,315		probably benign	Het
Srgap3	T	A	6: 112,739,078	D627V	probably damaging	Het
Tacc2	T	A	7: 130,674,606	S1796T	probably damaging	Het
Tcrg-C4	A	T	13: 19,352,307	R178S	unknown	Het
Tmco3	G	A	8: 13,294,870	V217I	probably damaging	Het
Tspan10	A	T	11: 120,444,715	Y217F	possibly damaging	Het
Usp3	G	A	9: 66,544,021	T153M	possibly damaging	Het
Xdh	G	T	17: 73,897,764	T1067K	probably benign	Het
Zfp334	T	C	2: 165,380,584	D513G	probably benign	Het

Other mutations in Prtg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00597:Prtg	APN	9	72809644	missense	probably damaging	1.00
IGL00942:Prtg	APN	9	72892340	missense	possibly damaging	0.82
IGL01821:Prtg	APN	9	72911937	missense	probably damaging	0.98
IGL01901:Prtg	APN	9	72855066	missense	probably damaging	1.00
IGL02143:Prtg	APN	9	72892324	missense	probably damaging	1.00
IGL02232:Prtg	APN	9	72851489	missense	probably damaging	1.00
IGL02451:Prtg	APN	9	72856999	missense	possibly damaging	0.95
IGL02510:Prtg	APN	9	72890869	missense	probably damaging	0.99
IGL02739:Prtg	APN	9	72851585	missense	possibly damaging	0.92
IGL03136:Prtg	APN	9	72856985	missense	possibly damaging	0.91
FR4548:Prtg	UTSW	9	72857081	critical splice donor site	probably benign
FR4589:Prtg	UTSW	9	72856865	missense	probably damaging	1.00
FR4737:Prtg	UTSW	9	72857081	critical splice donor site	probably benign
R0130:Prtg	UTSW	9	72809716	missense	probably damaging	1.00
R0321:Prtg	UTSW	9	72848025	missense	possibly damaging	0.83
R0390:Prtg	UTSW	9	72844958	missense	probably benign	0.24
R0900:Prtg	UTSW	9	72844943	missense	probably benign
R1121:Prtg	UTSW	9	72906167	missense	probably benign	0.15
R1438:Prtg	UTSW	9	72910750	splice site	probably benign
R1537:Prtg	UTSW	9	72809757	missense	probably benign	0.00
R1590:Prtg	UTSW	9	72842807	missense	probably benign
R1626:Prtg	UTSW	9	72844911	missense	probably damaging	1.00
R1965:Prtg	UTSW	9	72848322	missense	probably benign	0.27
R1993:Prtg	UTSW	9	72844896	missense	probably benign
R2351:Prtg	UTSW	9	72856824	missense	probably damaging	1.00
R3737:Prtg	UTSW	9	72842709	nonsense	probably null
R3921:Prtg	UTSW	9	72848347	missense	probably damaging	0.98
R4035:Prtg	UTSW	9	72842709	nonsense	probably null
R4378:Prtg	UTSW	9	72842760	missense	possibly damaging	0.91
R4687:Prtg	UTSW	9	72890798	missense	probably damaging	1.00
R5469:Prtg	UTSW	9	72891965	missense	probably damaging	0.98
R5563:Prtg	UTSW	9	72856898	missense	probably damaging	1.00
R5710:Prtg	UTSW	9	72809640	missense	probably damaging	1.00
R5738:Prtg	UTSW	9	72912006	missense	probably benign	0.16
R5868:Prtg	UTSW	9	72809717	nonsense	probably null
R5961:Prtg	UTSW	9	72856946	missense	probably benign
R5964:Prtg	UTSW	9	72892254	missense	probably benign	0.41
R6217:Prtg	UTSW	9	72904794	missense	probably damaging	1.00
R6306:Prtg	UTSW	9	72906186	missense	probably benign	0.42
R6395:Prtg	UTSW	9	72912132	missense	possibly damaging	0.80
R6455:Prtg	UTSW	9	72907856	missense	probably damaging	1.00
R6673:Prtg	UTSW	9	72851682	missense	probably damaging	0.99
R6985:Prtg	UTSW	9	72851501	missense	probably damaging	1.00
R7014:Prtg	UTSW	9	72891985	missense	possibly damaging	0.95
R7233:Prtg	UTSW	9	72911991	missense	probably benign	0.00
R7261:Prtg	UTSW	9	72907835	missense	possibly damaging	0.94
R7324:Prtg	UTSW	9	72890840	missense	probably damaging	0.96
R7372:Prtg	UTSW	9	72851566	nonsense	probably null
R7808:Prtg	UTSW	9	72842697	missense	possibly damaging	0.81
X0028:Prtg	UTSW	9	72851716	missense	possibly damaging	0.55
X0064:Prtg	UTSW	9	72904892	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGAAAACAGCCAAGGATCTG -3'
(R):5'- TGGTCCTCAGGGTGAAAATCTC -3'

Sequencing Primer
(F):5'- ACAGCCAAGGATCTGTTCTG -3'
(R):5'- TAGTCCAGGATGGCCATGAACTTC -3'

Posted On

2016-10-24