Mutagenetix > Incidental Mutations

Incidental Mutation 'R5556:Ptprr'

435400

Institutional Source

Beutler Lab

Gene Symbol

Ptprr

Ensembl Gene

ENSMUSG00000020151

Gene Name

protein tyrosine phosphatase, receptor type, R

Synonyms

PTPBR7, PTP-SL, RPTPRR

MMRRC Submission

043113-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.349) question?

Stock #

R5556 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116018213-116274932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116251149 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 267 (Y267C)

Ref Sequence

ENSEMBL: ENSMUSP00000122259 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271] [ENSMUST00000128399] [ENSMUST00000148731] [ENSMUST00000155606]

Predicted Effect

probably damaging
Transcript: ENSMUST00000063470
AA Change: Y511C

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: Y511C

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
transmembrane domain	226	248	N/A	INTRINSIC
PTPc	391	648	3.74e-108	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105271
AA Change: Y404C

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151
AA Change: Y404C

Domain	Start	End	E-Value	Type
transmembrane domain	119	141	N/A	INTRINSIC
PTPc	284	541	3.74e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000128399
AA Change: Y267C

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000114455
Gene: ENSMUSG00000020151
AA Change: Y267C

Domain	Start	End	E-Value	Type
PTPc	147	404	3.74e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000148731
AA Change: Y267C

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000120965
Gene: ENSMUSG00000020151
AA Change: Y267C

Domain	Start	End	E-Value	Type
PTPc	147	404	3.74e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155606
AA Change: Y267C

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000122259
Gene: ENSMUSG00000020151
AA Change: Y267C

Domain	Start	End	E-Value	Type
PTPc	147	404	3.74e-108	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,693,167	Q456K	probably benign	Het
4933427D14Rik	T	A	11: 72,175,200		probably null	Het
Abca13	A	T	11: 9,258,546	I240F	possibly damaging	Het
Accs	A	G	2: 93,836,083	Y420H	probably damaging	Het
Aco2	T	C	15: 81,889,319	Y20H	probably damaging	Het
Adck2	T	C	6: 39,583,935	V419A	probably benign	Het
Bahd1	T	A	2: 118,916,270	N123K	probably damaging	Het
BC027072	T	C	17: 71,752,425	K86E	possibly damaging	Het
Cast	A	G	13: 74,695,889		probably null	Het
Cd164l2	T	A	4: 133,223,705	V157E	probably damaging	Het
Cdk11b	C	T	4: 155,634,147	Q185*	probably null	Het
Ces2g	T	C	8: 104,967,442	F470S	probably benign	Het
Cherp	C	G	8: 72,467,980	Q313H	probably damaging	Het
Chrna4	A	G	2: 181,033,980	V110A	possibly damaging	Het
Cndp2	A	G	18: 84,672,124	V231A	probably benign	Het
Cst7	A	T	2: 150,570,568	H17L	probably benign	Het
Decr1	C	T	4: 15,919,244	D300N	probably damaging	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dgkb	T	G	12: 38,127,364	V230G	probably damaging	Het
Dis3l2	T	C	1: 86,973,404	V439A	possibly damaging	Het
Disp3	C	T	4: 148,258,157	G612D	probably benign	Het
Dock7	T	C	4: 98,944,735	T1962A	probably damaging	Het
Fam189a1	A	G	7: 64,856,209	F96S	probably damaging	Het
Fibp	T	A	19: 5,464,199	V304E	possibly damaging	Het
Flt3	T	A	5: 147,332,997		probably null	Het
Kifc3	G	A	8: 95,108,459	Q233*	probably null	Het
Klhl42	C	A	6: 147,108,112	S483Y	probably benign	Het
Map3k19	G	A	1: 127,834,547	R276*	probably null	Het
Mecom	A	G	3: 30,238,100	S87P	probably damaging	Het
Med13	A	G	11: 86,327,838	V416A	probably benign	Het
Mepe	G	A	5: 104,338,212	G406D	probably damaging	Het
Met	T	G	6: 17,534,176	L673V	probably benign	Het
Mlh3	A	T	12: 85,268,493	Y306*	probably null	Het
Nrxn2	C	A	19: 6,490,091	A814E	probably damaging	Het
Nsmaf	C	T	4: 6,398,621	V828I	probably benign	Het
Olfr137	T	A	17: 38,305,073	K129N	possibly damaging	Het
Olfr824	A	T	10: 130,126,859	L66H	probably damaging	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pcdhb6	T	A	18: 37,334,389	L121Q	probably damaging	Het
Plekha7	G	A	7: 116,164,149	T406I	probably benign	Het
Prtg	T	C	9: 72,851,704	S447P	probably damaging	Het
Rbpjl	A	G	2: 164,408,062	T134A	probably benign	Het
Rpe	C	A	1: 66,706,466	T55N	probably damaging	Het
Scn1a	T	C	2: 66,324,797	D606G	probably benign	Het
Setd5	T	A	6: 113,147,502	N1105K	probably benign	Het
Sh3d21	T	C	4: 126,162,236	N126D	possibly damaging	Het
Shank1	A	G	7: 44,344,315		probably benign	Het
Srgap3	T	A	6: 112,739,078	D627V	probably damaging	Het
Tacc2	T	A	7: 130,674,606	S1796T	probably damaging	Het
Tcrg-C4	A	T	13: 19,352,307	R178S	unknown	Het
Tmco3	G	A	8: 13,294,870	V217I	probably damaging	Het
Tspan10	A	T	11: 120,444,715	Y217F	possibly damaging	Het
Usp3	G	A	9: 66,544,021	T153M	possibly damaging	Het
Xdh	G	T	17: 73,897,764	T1067K	probably benign	Het
Zfp334	T	C	2: 165,380,584	D513G	probably benign	Het

Other mutations in Ptprr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Ptprr	APN	10	116188317	missense	probably benign	0.00
IGL01762:Ptprr	APN	10	116236733	missense	probably damaging	1.00
IGL02429:Ptprr	APN	10	116273767	missense	probably damaging	0.99
IGL03396:Ptprr	APN	10	116188330	missense	probably damaging	1.00
R0268:Ptprr	UTSW	10	116252963	missense	possibly damaging	0.83
R0584:Ptprr	UTSW	10	116251158	missense	probably damaging	0.96
R1388:Ptprr	UTSW	10	116273752	missense	probably benign	0.14
R1438:Ptprr	UTSW	10	116256204	missense	probably damaging	0.98
R1533:Ptprr	UTSW	10	116188208	nonsense	probably null
R1654:Ptprr	UTSW	10	116188363	missense	probably benign	0.43
R1793:Ptprr	UTSW	10	116252922	missense	probably damaging	1.00
R4081:Ptprr	UTSW	10	116236710	missense	probably benign	0.01
R4193:Ptprr	UTSW	10	116252864	missense	probably damaging	1.00
R4254:Ptprr	UTSW	10	116162443	splice site	probably null
R4496:Ptprr	UTSW	10	116229502	missense	possibly damaging	0.91
R4799:Ptprr	UTSW	10	116048218	missense	probably benign	0.00
R5209:Ptprr	UTSW	10	116162609	missense	probably damaging	0.99
R5312:Ptprr	UTSW	10	116188419	missense	probably benign	0.28
R5410:Ptprr	UTSW	10	116188330	missense	possibly damaging	0.94
R5717:Ptprr	UTSW	10	116048113	missense	probably benign	0.11
R6039:Ptprr	UTSW	10	116236763	splice site	probably null
R6039:Ptprr	UTSW	10	116236763	splice site	probably null
R7013:Ptprr	UTSW	10	116236754	missense	probably damaging	1.00
R7401:Ptprr	UTSW	10	116048236	missense	probably benign
R7527:Ptprr	UTSW	10	116251199	missense	probably benign	0.08
R7644:Ptprr	UTSW	10	116048228	missense	probably benign	0.00
R7651:Ptprr	UTSW	10	116251179	missense	probably benign	0.01
R7708:Ptprr	UTSW	10	116162597	missense	probably benign	0.31
R7731:Ptprr	UTSW	10	116237295	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGTCTGCACATCATAGAGTTC -3'
(R):5'- CAACAAGGGACGTCGATAGC -3'

Sequencing Primer
(F):5'- TGCACATCATAGAGTTCACCTC -3'
(R):5'- AAGGGACGTCGATAGCTTGCC -3'

Posted On

2016-10-24