Incidental Mutation 'R5556:Olfr824'
ID435401
Institutional Source Beutler Lab
Gene Symbol Olfr824
Ensembl Gene ENSMUSG00000095804
Gene Nameolfactory receptor 824
SynonymsGA_x6K02T2PULF-11797746-11796799, MOR210-3
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location130123470-130130000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130126859 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 66 (L66H)
Ref Sequence ENSEMBL: ENSMUSP00000150606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074161] [ENSMUST00000214192] [ENSMUST00000215217]
Predicted Effect probably damaging
Transcript: ENSMUST00000074161
AA Change: L66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073794
Gene: ENSMUSG00000095804
AA Change: L66H

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.6e-54 PFAM
Pfam:7tm_1 44 293 3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214192
AA Change: L66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215217
AA Change: L66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Olfr824
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr824 APN 10 130126991 missense probably benign 0.45
IGL02391:Olfr824 APN 10 130126904 missense possibly damaging 0.75
IGL03247:Olfr824 APN 10 130126715 missense probably damaging 1.00
R0781:Olfr824 UTSW 10 130126653 missense probably damaging 1.00
R1110:Olfr824 UTSW 10 130126653 missense probably damaging 1.00
R1694:Olfr824 UTSW 10 130126254 missense possibly damaging 0.93
R2069:Olfr824 UTSW 10 130126205 missense possibly damaging 0.94
R2173:Olfr824 UTSW 10 130126503 missense probably benign 0.10
R4078:Olfr824 UTSW 10 130126718 missense probably damaging 1.00
R4864:Olfr824 UTSW 10 130126887 nonsense probably null
R6704:Olfr824 UTSW 10 130126155 nonsense probably null
R7624:Olfr824 UTSW 10 130126586 missense probably damaging 0.98
R8013:Olfr824 UTSW 10 130126778 missense probably damaging 1.00
R8049:Olfr824 UTSW 10 130126600 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGGCTGAGACATATGGAC -3'
(R):5'- GCAGGAACTATACTGAGCTGAC -3'

Sequencing Primer
(F):5'- CTGAGAAGCGGTCATAAGCCATC -3'
(R):5'- ACTGAGCTGACAGACTTTATCCTG -3'
Posted On2016-10-24