Incidental Mutation 'R5556:4933427D14Rik'
List |< first << previous [record 2 of 56] next >> last >|
ID435403
Institutional Source Beutler Lab
Gene Symbol 4933427D14Rik
Ensembl Gene ENSMUSG00000020807
Gene NameRIKEN cDNA 4933427D14 gene
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72153929-72207459 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 72175200 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108506] [ENSMUST00000131546] [ENSMUST00000142530]
Predicted Effect probably null
Transcript: ENSMUST00000108506
SMART Domains Protein: ENSMUSP00000104146
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
Pfam:DUF4673 1 954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131546
SMART Domains Protein: ENSMUSP00000122273
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
coiled coil region 625 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142530
SMART Domains Protein: ENSMUSP00000115276
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156696
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in 4933427D14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:4933427D14Rik APN 11 72178504 missense probably damaging 1.00
IGL01643:4933427D14Rik APN 11 72191588 missense probably damaging 1.00
IGL02004:4933427D14Rik APN 11 72191597 missense possibly damaging 0.62
IGL02308:4933427D14Rik APN 11 72202482 missense probably damaging 1.00
IGL02378:4933427D14Rik APN 11 72189598 missense probably benign 0.02
IGL02715:4933427D14Rik APN 11 72198888 missense probably damaging 1.00
IGL03330:4933427D14Rik APN 11 72159428 missense probably damaging 1.00
IGL03384:4933427D14Rik APN 11 72195847 missense possibly damaging 0.87
BB002:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
BB012:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
IGL03047:4933427D14Rik UTSW 11 72166726 missense possibly damaging 0.74
R0114:4933427D14Rik UTSW 11 72195799 missense probably damaging 1.00
R0526:4933427D14Rik UTSW 11 72169783 missense probably damaging 1.00
R0653:4933427D14Rik UTSW 11 72175545 nonsense probably null
R0669:4933427D14Rik UTSW 11 72198845 missense possibly damaging 0.73
R0729:4933427D14Rik UTSW 11 72159455 missense probably benign 0.07
R1797:4933427D14Rik UTSW 11 72198459 missense possibly damaging 0.77
R3973:4933427D14Rik UTSW 11 72198741 missense probably damaging 1.00
R4744:4933427D14Rik UTSW 11 72175539 missense probably damaging 0.98
R4897:4933427D14Rik UTSW 11 72191516 missense probably damaging 1.00
R5023:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5057:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5100:4933427D14Rik UTSW 11 72166651 missense probably damaging 1.00
R5497:4933427D14Rik UTSW 11 72165534 missense probably benign 0.22
R5631:4933427D14Rik UTSW 11 72176764 missense possibly damaging 0.71
R5683:4933427D14Rik UTSW 11 72202440 missense probably benign
R5742:4933427D14Rik UTSW 11 72165553 missense possibly damaging 0.63
R6247:4933427D14Rik UTSW 11 72158942 missense probably benign 0.02
R6267:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6296:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6860:4933427D14Rik UTSW 11 72189586 missense probably damaging 1.00
R7023:4933427D14Rik UTSW 11 72178403 critical splice donor site probably null
R7328:4933427D14Rik UTSW 11 72169780 critical splice donor site probably null
R7514:4933427D14Rik UTSW 11 72195802 missense probably damaging 1.00
R7544:4933427D14Rik UTSW 11 72198939 missense probably damaging 1.00
R7925:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
R8204:4933427D14Rik UTSW 11 72166780 missense probably benign 0.01
R8280:4933427D14Rik UTSW 11 72195841 missense possibly damaging 0.70
R8316:4933427D14Rik UTSW 11 72168786 missense possibly damaging 0.70
R8366:4933427D14Rik UTSW 11 72176695 nonsense probably null
R8384:4933427D14Rik UTSW 11 72166765 missense probably benign 0.08
R8722:4933427D14Rik UTSW 11 72189596 missense probably benign 0.00
X0063:4933427D14Rik UTSW 11 72176769 missense probably benign
X0065:4933427D14Rik UTSW 11 72189575 missense possibly damaging 0.65
Z1176:4933427D14Rik UTSW 11 72159000 missense probably benign 0.12
Z1186:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1186:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1186:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195710 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1187:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1187:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1188:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1188:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1189:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1189:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1190:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1190:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1191:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1191:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1192:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1192:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGTGCCTTGGGATATAAG -3'
(R):5'- CCTAGGAAGTCTTCAGGAGAGC -3'

Sequencing Primer
(F):5'- CCTTGGGATATAAGGCAGCAAAC -3'
(R):5'- TCTTCAGGAGAGCAGAGATAGAAGC -3'
Posted On2016-10-24