Mutagenetix > Incidental Mutation

Incidental Mutation 'R5556:Med13'

435404

Institutional Source

Beutler Lab

Gene Symbol

Med13

Ensembl Gene

ENSMUSG00000034297

Gene Name

mediator complex subunit 13

Synonyms

Thrap1, 1110067M05Rik, Trap240

MMRRC Submission

043113-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R5556 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86267033-86357602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86327838 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 416 (V416A)

Ref Sequence

ENSEMBL: ENSMUSP00000044268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043624]

AlphaFold

Q5SWW4

Predicted Effect

probably benign
Transcript: ENSMUST00000043624
AA Change: V416A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: V416A

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	384	5e-130	PFAM
low complexity region	438	451	N/A	INTRINSIC
low complexity region	531	540	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	984	998	N/A	INTRINSIC
low complexity region	1001	1029	N/A	INTRINSIC
low complexity region	1463	1476	N/A	INTRINSIC
low complexity region	1502	1517	N/A	INTRINSIC
low complexity region	1522	1550	N/A	INTRINSIC
low complexity region	1559	1570	N/A	INTRINSIC
low complexity region	1577	1596	N/A	INTRINSIC
Pfam:Med13_C	1637	2161	3.5e-146	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144983

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,693,167	Q456K	probably benign	Het
4933427D14Rik	T	A	11: 72,175,200		probably null	Het
Abca13	A	T	11: 9,258,546	I240F	possibly damaging	Het
Accs	A	G	2: 93,836,083	Y420H	probably damaging	Het
Aco2	T	C	15: 81,889,319	Y20H	probably damaging	Het
Adck2	T	C	6: 39,583,935	V419A	probably benign	Het
Bahd1	T	A	2: 118,916,270	N123K	probably damaging	Het
BC027072	T	C	17: 71,752,425	K86E	possibly damaging	Het
Cast	A	G	13: 74,695,889		probably null	Het
Cd164l2	T	A	4: 133,223,705	V157E	probably damaging	Het
Cdk11b	C	T	4: 155,634,147	Q185*	probably null	Het
Ces2g	T	C	8: 104,967,442	F470S	probably benign	Het
Cherp	C	G	8: 72,467,980	Q313H	probably damaging	Het
Chrna4	A	G	2: 181,033,980	V110A	possibly damaging	Het
Cndp2	A	G	18: 84,672,124	V231A	probably benign	Het
Cst7	A	T	2: 150,570,568	H17L	probably benign	Het
Decr1	C	T	4: 15,919,244	D300N	probably damaging	Het
Dennd4b	G	A	3: 90,268,368	R148Q	probably damaging	Het
Dgkb	T	G	12: 38,127,364	V230G	probably damaging	Het
Dis3l2	T	C	1: 86,973,404	V439A	possibly damaging	Het
Disp3	C	T	4: 148,258,157	G612D	probably benign	Het
Dock7	T	C	4: 98,944,735	T1962A	probably damaging	Het
Fam189a1	A	G	7: 64,856,209	F96S	probably damaging	Het
Fibp	T	A	19: 5,464,199	V304E	possibly damaging	Het
Flt3	T	A	5: 147,332,997		probably null	Het
Kifc3	G	A	8: 95,108,459	Q233*	probably null	Het
Klhl42	C	A	6: 147,108,112	S483Y	probably benign	Het
Map3k19	G	A	1: 127,834,547	R276*	probably null	Het
Mecom	A	G	3: 30,238,100	S87P	probably damaging	Het
Mepe	G	A	5: 104,338,212	G406D	probably damaging	Het
Met	T	G	6: 17,534,176	L673V	probably benign	Het
Mlh3	A	T	12: 85,268,493	Y306*	probably null	Het
Nrxn2	C	A	19: 6,490,091	A814E	probably damaging	Het
Nsmaf	C	T	4: 6,398,621	V828I	probably benign	Het
Olfr137	T	A	17: 38,305,073	K129N	possibly damaging	Het
Olfr824	A	T	10: 130,126,859	L66H	probably damaging	Het
Panx1	A	G	9: 15,007,633	I310T	possibly damaging	Het
Pcdhb6	T	A	18: 37,334,389	L121Q	probably damaging	Het
Plekha7	G	A	7: 116,164,149	T406I	probably benign	Het
Prtg	T	C	9: 72,851,704	S447P	probably damaging	Het
Ptprr	A	G	10: 116,251,149	Y267C	probably damaging	Het
Rbpjl	A	G	2: 164,408,062	T134A	probably benign	Het
Rpe	C	A	1: 66,706,466	T55N	probably damaging	Het
Scn1a	T	C	2: 66,324,797	D606G	probably benign	Het
Setd5	T	A	6: 113,147,502	N1105K	probably benign	Het
Sh3d21	T	C	4: 126,162,236	N126D	possibly damaging	Het
Shank1	A	G	7: 44,344,315		probably benign	Het
Srgap3	T	A	6: 112,739,078	D627V	probably damaging	Het
Tacc2	T	A	7: 130,674,606	S1796T	probably damaging	Het
Tcrg-C4	A	T	13: 19,352,307	R178S	unknown	Het
Tmco3	G	A	8: 13,294,870	V217I	probably damaging	Het
Tspan10	A	T	11: 120,444,715	Y217F	possibly damaging	Het
Usp3	G	A	9: 66,544,021	T153M	possibly damaging	Het
Xdh	G	T	17: 73,897,764	T1067K	probably benign	Het
Zfp334	T	C	2: 165,380,584	D513G	probably benign	Het

Other mutations in Med13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Med13	APN	11	86291040	splice site	probably benign
IGL01391:Med13	APN	11	86328497	missense	probably benign
IGL01767:Med13	APN	11	86319783	missense	probably benign	0.38
IGL01830:Med13	APN	11	86288928	splice site	probably benign
IGL01859:Med13	APN	11	86283751	missense	possibly damaging	0.86
IGL01924:Med13	APN	11	86308696	splice site	probably benign
IGL02080:Med13	APN	11	86283812	missense	probably damaging	0.97
IGL02138:Med13	APN	11	86286765	missense	probably damaging	0.99
IGL02259:Med13	APN	11	86357501	missense	possibly damaging	0.89
IGL02339:Med13	APN	11	86288939	missense	probably benign	0.16
IGL02399:Med13	APN	11	86283945	splice site	probably benign
IGL02646:Med13	APN	11	86283386	missense	probably benign	0.00
IGL03227:Med13	APN	11	86327792	splice site	probably benign
R0197_Med13_854	UTSW	11	86307038	missense	probably benign	0.13
R0360_Med13_060	UTSW	11	86329161	splice site	probably benign
R2359_Med13_079	UTSW	11	86291035	splice site	probably benign
R3735_Med13_085	UTSW	11	86279658	missense	probably benign	0.00
R4974_Med13_508	UTSW	11	86298847	missense	probably damaging	0.98
R0116:Med13	UTSW	11	86319897	missense	probably damaging	0.99
R0189:Med13	UTSW	11	86319876	missense	probably benign
R0197:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0206:Med13	UTSW	11	86300856	splice site	probably benign
R0208:Med13	UTSW	11	86300856	splice site	probably benign
R0310:Med13	UTSW	11	86346003	missense	probably benign	0.11
R0360:Med13	UTSW	11	86329161	splice site	probably benign
R0413:Med13	UTSW	11	86299207	splice site	probably benign
R0482:Med13	UTSW	11	86285151	missense	probably benign	0.41
R0497:Med13	UTSW	11	86276983	splice site	probably benign
R0589:Med13	UTSW	11	86283249	missense	probably damaging	1.00
R0601:Med13	UTSW	11	86345962	missense	possibly damaging	0.47
R0646:Med13	UTSW	11	86331089	missense	possibly damaging	0.95
R0701:Med13	UTSW	11	86307038	missense	probably benign	0.13
R0709:Med13	UTSW	11	86319596	missense	possibly damaging	0.95
R0711:Med13	UTSW	11	86301353	splice site	probably benign
R0734:Med13	UTSW	11	86301237	missense	probably benign
R0883:Med13	UTSW	11	86307038	missense	probably benign	0.13
R1793:Med13	UTSW	11	86329351	missense	probably benign	0.45
R1926:Med13	UTSW	11	86289073	missense	possibly damaging	0.47
R1959:Med13	UTSW	11	86298979	missense	probably damaging	1.00
R2286:Med13	UTSW	11	86319689	missense	probably benign	0.05
R2359:Med13	UTSW	11	86291035	splice site	probably benign
R2444:Med13	UTSW	11	86331960	missense	probably damaging	1.00
R2679:Med13	UTSW	11	86298577	missense	probably benign	0.00
R2879:Med13	UTSW	11	86299162	missense	possibly damaging	0.61
R3439:Med13	UTSW	11	86285297	missense	probably damaging	1.00
R3735:Med13	UTSW	11	86279658	missense	probably benign	0.00
R4333:Med13	UTSW	11	86288183	missense	probably benign
R4558:Med13	UTSW	11	86299054	missense	probably damaging	1.00
R4598:Med13	UTSW	11	86278566	missense	probably damaging	0.97
R4773:Med13	UTSW	11	86276920	missense	probably damaging	0.99
R4801:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4802:Med13	UTSW	11	86278773	missense	probably damaging	1.00
R4806:Med13	UTSW	11	86298577	missense	probably benign	0.00
R4940:Med13	UTSW	11	86288118	missense	probably damaging	1.00
R4974:Med13	UTSW	11	86298847	missense	probably damaging	0.98
R5056:Med13	UTSW	11	86328565	missense	probably benign	0.00
R5133:Med13	UTSW	11	86319849	missense	probably benign	0.32
R5206:Med13	UTSW	11	86319879	missense	probably damaging	1.00
R5352:Med13	UTSW	11	86301468	missense	possibly damaging	0.82
R5534:Med13	UTSW	11	86319365	missense	probably benign	0.09
R5633:Med13	UTSW	11	86278931	splice site	probably benign
R5769:Med13	UTSW	11	86346003	missense	probably benign	0.11
R6236:Med13	UTSW	11	86328531	missense	probably damaging	0.99
R6479:Med13	UTSW	11	86357527	start gained	probably benign
R6487:Med13	UTSW	11	86331150	missense	probably damaging	1.00
R6524:Med13	UTSW	11	86301467	missense	probably damaging	0.98
R6528:Med13	UTSW	11	86298954	missense	probably damaging	1.00
R6805:Med13	UTSW	11	86278796	missense	possibly damaging	0.48
R6913:Med13	UTSW	11	86319876	missense	probably benign
R7221:Med13	UTSW	11	86288095	missense	probably benign	0.00
R7254:Med13	UTSW	11	86319835	missense	probably benign
R7267:Med13	UTSW	11	86308826	missense	probably benign	0.01
R7309:Med13	UTSW	11	86291062	missense	probably benign	0.00
R7404:Med13	UTSW	11	86286446	missense	possibly damaging	0.53
R7586:Med13	UTSW	11	86271002	missense	probably damaging	0.99
R7704:Med13	UTSW	11	86345918	nonsense	probably null
R7922:Med13	UTSW	11	86271005	missense	probably damaging	0.98
R7943:Med13	UTSW	11	86278526	missense	probably damaging	0.97
R8062:Med13	UTSW	11	86319438	missense	probably benign
R8075:Med13	UTSW	11	86272470	missense	probably damaging	0.98
R8207:Med13	UTSW	11	86303549	missense	probably damaging	1.00
R8671:Med13	UTSW	11	86271097	missense	probably damaging	1.00
R9056:Med13	UTSW	11	86298834	nonsense	probably null
R9084:Med13	UTSW	11	86300795	missense	probably damaging	1.00
R9148:Med13	UTSW	11	86301471	missense	probably benign	0.27
R9329:Med13	UTSW	11	86298457	missense	probably benign	0.10
R9380:Med13	UTSW	11	86286772	missense	probably benign	0.42
R9515:Med13	UTSW	11	86308901	missense	probably benign	0.00
R9516:Med13	UTSW	11	86288975	missense	probably benign	0.01
R9690:Med13	UTSW	11	86278844	missense	probably damaging	1.00
R9751:Med13	UTSW	11	86299158	missense	probably damaging	1.00
R9752:Med13	UTSW	11	86283321	missense	possibly damaging	0.87
R9764:Med13	UTSW	11	86286519	missense	possibly damaging	0.89
Z1176:Med13	UTSW	11	86328544	missense	possibly damaging	0.91
Z1176:Med13	UTSW	11	86345862	missense	probably benign	0.45
Z1176:Med13	UTSW	11	86355423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTAATCAGCTTGAAATTGTTGGC -3'
(R):5'- CTTGCATGCTGCTTAATAGTATGG -3'

Sequencing Primer
(F):5'- AGCTTGAAATTGTTGGCTATCTTTTC -3'
(R):5'- CCTGGTTTACAAACTGAGTCCAGG -3'

Posted On

2016-10-24