Incidental Mutation 'R5556:Dgkb'
List |< first << previous [record 19 of 56] next >> last >|
ID435407
Institutional Source Beutler Lab
Gene Symbol Dgkb
Ensembl Gene ENSMUSG00000036095
Gene Namediacylglycerol kinase, beta
SynonymsC630029D13Rik, DGK-beta
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location37817726-38634239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38127364 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 230 (V230G)
Ref Sequence ENSEMBL: ENSMUSP00000152446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040500] [ENSMUST00000220990] [ENSMUST00000221176]
Predicted Effect probably damaging
Transcript: ENSMUST00000040500
AA Change: V223G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037900
Gene: ENSMUSG00000036095
AA Change: V223G

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 6 141 1.4e-49 PFAM
EFh 145 173 1.82e-4 SMART
EFh 190 218 1.18e-3 SMART
C1 235 286 7.11e-16 SMART
C1 302 350 9.25e-6 SMART
DAGKc 429 553 2.58e-68 SMART
DAGKa 573 753 8.02e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220606
Predicted Effect probably damaging
Transcript: ENSMUST00000220990
AA Change: V223G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221098
Predicted Effect probably damaging
Transcript: ENSMUST00000221176
AA Change: V230G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221540
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diacylglycerol kinases (DGKs) are regulators of the intracellular concentration of the second messenger diacylglycerol (DAG) and thus play a key role in cellular processes. Nine mammalian isotypes have been identified, which are encoded by separate genes. Mammalian DGK isozymes contain a conserved catalytic (kinase) domain and a cysteine-rich domain (CRD). The protein encoded by this gene is a diacylglycerol kinase, beta isotype. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon distruption have defects in long term potentiation, synapase morphology, and in spatial reference and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Dgkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Dgkb APN 12 38438568 missense probably benign 0.05
IGL00768:Dgkb APN 12 38427479 missense probably benign 0.00
IGL00792:Dgkb APN 12 38214389 critical splice donor site probably null
IGL00934:Dgkb APN 12 38427456 missense probably damaging 0.98
IGL00970:Dgkb APN 12 38190083 missense probably damaging 1.00
IGL01152:Dgkb APN 12 38084234 missense probably damaging 1.00
IGL01489:Dgkb APN 12 38127385 critical splice donor site probably null
IGL01993:Dgkb APN 12 37982010 missense probably benign 0.19
IGL02212:Dgkb APN 12 38139414 missense probably damaging 1.00
IGL02687:Dgkb APN 12 38630629 missense possibly damaging 0.94
IGL02986:Dgkb APN 12 38100400 missense possibly damaging 0.88
IGL03155:Dgkb APN 12 38139459 missense probably damaging 1.00
IGL03174:Dgkb APN 12 38216054 missense possibly damaging 0.93
IGL03198:Dgkb APN 12 38136616 missense probably damaging 0.97
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0078:Dgkb UTSW 12 38136541 missense probably benign 0.35
R0271:Dgkb UTSW 12 38228026 missense probably damaging 1.00
R0359:Dgkb UTSW 12 38216031 missense probably benign 0.17
R0396:Dgkb UTSW 12 38190135 critical splice donor site probably null
R0547:Dgkb UTSW 12 38604158 missense probably benign 0.39
R0554:Dgkb UTSW 12 38216031 missense probably benign 0.17
R1903:Dgkb UTSW 12 38166777 critical splice donor site probably null
R2004:Dgkb UTSW 12 38084229 missense probably damaging 1.00
R2265:Dgkb UTSW 12 38190108 missense possibly damaging 0.61
R2941:Dgkb UTSW 12 38604123 missense possibly damaging 0.96
R3177:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R3277:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R4319:Dgkb UTSW 12 38438599 missense probably damaging 1.00
R4446:Dgkb UTSW 12 38184953 missense probably damaging 0.99
R4578:Dgkb UTSW 12 38427493 missense possibly damaging 0.87
R4601:Dgkb UTSW 12 38602820 missense probably damaging 0.96
R4799:Dgkb UTSW 12 38114568 missense possibly damaging 0.89
R4937:Dgkb UTSW 12 38114658 nonsense probably null
R5380:Dgkb UTSW 12 38127300 missense possibly damaging 0.89
R5485:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R6198:Dgkb UTSW 12 38173823 missense probably benign
R6467:Dgkb UTSW 12 38084224 missense possibly damaging 0.65
R6467:Dgkb UTSW 12 38604105 missense probably damaging 1.00
R6792:Dgkb UTSW 12 38100425 missense possibly damaging 0.48
R7056:Dgkb UTSW 12 38100493 missense probably benign
R7116:Dgkb UTSW 12 37981990 missense probably benign 0.00
R7251:Dgkb UTSW 12 37981986 missense possibly damaging 0.77
R7265:Dgkb UTSW 12 38184932 missense possibly damaging 0.91
R7268:Dgkb UTSW 12 38147555 nonsense probably null
R7342:Dgkb UTSW 12 38100433 missense probably benign 0.00
R7535:Dgkb UTSW 12 38136647 missense probably damaging 1.00
R7540:Dgkb UTSW 12 37981790 start gained probably benign
R7584:Dgkb UTSW 12 38139392 splice site probably null
R7714:Dgkb UTSW 12 38630593 missense probably damaging 0.99
R7885:Dgkb UTSW 12 38139426 missense probably damaging 1.00
R8012:Dgkb UTSW 12 38139486 missense probably benign 0.31
R8050:Dgkb UTSW 12 38124217 missense probably benign 0.38
R8089:Dgkb UTSW 12 38184950 missense probably damaging 1.00
R8103:Dgkb UTSW 12 38136581 missense probably damaging 1.00
R8400:Dgkb UTSW 12 38602838 critical splice donor site probably null
R8418:Dgkb UTSW 12 38330017 missense probably damaging 1.00
R8473:Dgkb UTSW 12 38184940 missense probably damaging 0.99
R8744:Dgkb UTSW 12 38438612 missense probably damaging 0.98
X0023:Dgkb UTSW 12 38227989 missense probably benign 0.00
X0027:Dgkb UTSW 12 38228125 critical splice donor site probably null
Z1176:Dgkb UTSW 12 37981996 missense possibly damaging 0.77
Z1176:Dgkb UTSW 12 38136613 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACCAGCTAGAGAAAGTGTTTTG -3'
(R):5'- GTGTGTCCTGTCTCCACATG -3'

Sequencing Primer
(F):5'- AGAAAGTGTTTTGTTGAATTACAAGG -3'
(R):5'- CGCAGCATAGTTCACATCTATTTGTG -3'
Posted On2016-10-24