Incidental Mutation 'R5556:Mlh3'
ID435408
Institutional Source Beutler Lab
Gene Symbol Mlh3
Ensembl Gene ENSMUSG00000021245
Gene NamemutL homolog 3
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85234520-85270599 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 85268493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 306 (Y306*)
Ref Sequence ENSEMBL: ENSMUSP00000152840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000019378] [ENSMUST00000117138] [ENSMUST00000121930] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]
Predicted Effect probably benign
Transcript: ENSMUST00000008966
SMART Domains Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019378
AA Change: Y306*
SMART Domains Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: Y306*

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117138
SMART Domains Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121930
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166821
AA Change: Y306*
SMART Domains Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: Y306*

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000220854
AA Change: Y306*
Predicted Effect probably benign
Transcript: ENSMUST00000223230
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Mlh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Mlh3 APN 12 85267929 missense probably benign
IGL01462:Mlh3 APN 12 85266736 missense probably benign
IGL01961:Mlh3 APN 12 85266344 missense probably benign 0.00
IGL02596:Mlh3 APN 12 85240958 critical splice donor site probably null
IGL03008:Mlh3 APN 12 85240851 missense probably benign 0.23
IGL03142:Mlh3 APN 12 85250301 critical splice donor site probably null
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0078:Mlh3 UTSW 12 85268818 missense probably damaging 0.98
R0129:Mlh3 UTSW 12 85266140 splice site probably benign
R0269:Mlh3 UTSW 12 85268405 missense probably benign 0.00
R0393:Mlh3 UTSW 12 85267587 nonsense probably null
R0403:Mlh3 UTSW 12 85268968 missense possibly damaging 0.93
R0409:Mlh3 UTSW 12 85240854 missense possibly damaging 0.95
R0587:Mlh3 UTSW 12 85266419 missense probably benign 0.00
R0701:Mlh3 UTSW 12 85267903 missense probably benign 0.00
R0718:Mlh3 UTSW 12 85247697 missense possibly damaging 0.86
R0883:Mlh3 UTSW 12 85235714 missense possibly damaging 0.89
R0989:Mlh3 UTSW 12 85269395 missense probably benign 0.22
R0990:Mlh3 UTSW 12 85267765 missense probably benign
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1562:Mlh3 UTSW 12 85266920 missense probably benign 0.14
R1599:Mlh3 UTSW 12 85268369 missense probably damaging 1.00
R1694:Mlh3 UTSW 12 85267141 missense probably damaging 1.00
R1777:Mlh3 UTSW 12 85268754 missense possibly damaging 0.75
R1822:Mlh3 UTSW 12 85266145 splice site probably benign
R1874:Mlh3 UTSW 12 85237513 critical splice donor site probably null
R1914:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R1915:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R2075:Mlh3 UTSW 12 85269141 nonsense probably null
R2083:Mlh3 UTSW 12 85269041 missense probably benign 0.16
R2267:Mlh3 UTSW 12 85260811 missense possibly damaging 0.55
R2334:Mlh3 UTSW 12 85268077 missense probably benign 0.00
R2882:Mlh3 UTSW 12 85267566 missense probably damaging 1.00
R3623:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3624:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3963:Mlh3 UTSW 12 85268680 missense possibly damaging 0.94
R4376:Mlh3 UTSW 12 85259198 missense probably benign 0.00
R5334:Mlh3 UTSW 12 85245761 critical splice donor site probably null
R5526:Mlh3 UTSW 12 85269373 nonsense probably null
R5611:Mlh3 UTSW 12 85267445 missense probably benign 0.21
R5911:Mlh3 UTSW 12 85268455 missense probably damaging 1.00
R6050:Mlh3 UTSW 12 85240846 missense possibly damaging 0.89
R6221:Mlh3 UTSW 12 85268418 missense possibly damaging 0.94
R6377:Mlh3 UTSW 12 85268497 missense probably damaging 0.97
R6820:Mlh3 UTSW 12 85247723 missense probably damaging 1.00
R6826:Mlh3 UTSW 12 85245824 missense probably benign 0.38
R6992:Mlh3 UTSW 12 85235720 missense probably damaging 1.00
R7217:Mlh3 UTSW 12 85266707 missense probably benign
R7228:Mlh3 UTSW 12 85235656 missense probably benign 0.07
R7348:Mlh3 UTSW 12 85267441 missense probably damaging 0.99
R7599:Mlh3 UTSW 12 85268199 nonsense probably null
R7722:Mlh3 UTSW 12 85267492 missense probably benign 0.01
R7762:Mlh3 UTSW 12 85268284 missense possibly damaging 0.63
R7786:Mlh3 UTSW 12 85266737 missense probably benign 0.00
R8231:Mlh3 UTSW 12 85260798 critical splice donor site probably null
R8415:Mlh3 UTSW 12 85269080 missense probably benign 0.35
R8750:Mlh3 UTSW 12 85261714 missense probably damaging 0.99
R8794:Mlh3 UTSW 12 85235723 missense probably damaging 1.00
RF014:Mlh3 UTSW 12 85268029 missense probably benign
X0024:Mlh3 UTSW 12 85247669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAGAGTCGTGCCAAAC -3'
(R):5'- AATTTGAGTTCAGTGGCTACATCAG -3'

Sequencing Primer
(F):5'- GAGTCGTGCCAAACAAACTAAAAC -3'
(R):5'- TGAAGCACACTACAATAAGAATATGC -3'
Posted On2016-10-24