Incidental Mutation 'R5556:Cast'
ID435410
Institutional Source Beutler Lab
Gene Symbol Cast
Ensembl Gene ENSMUSG00000021585
Gene Namecalpastatin
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location74692368-74808810 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 74695889 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065629] [ENSMUST00000065629] [ENSMUST00000169114] [ENSMUST00000220738] [ENSMUST00000222588] [ENSMUST00000223033] [ENSMUST00000223126] [ENSMUST00000223206] [ENSMUST00000223309]
Predicted Effect probably null
Transcript: ENSMUST00000065629
SMART Domains Protein: ENSMUSP00000065275
Gene: ENSMUSG00000021585

DomainStartEndE-ValueType
Pfam:Calpain_inhib 15 272 8.1e-9 PFAM
Pfam:Calpain_inhib 279 404 2.7e-36 PFAM
Pfam:Calpain_inhib 415 544 3.6e-38 PFAM
Pfam:Calpain_inhib 556 684 4.5e-36 PFAM
low complexity region 708 744 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000065629
SMART Domains Protein: ENSMUSP00000065275
Gene: ENSMUSG00000021585

DomainStartEndE-ValueType
Pfam:Calpain_inhib 15 272 8.1e-9 PFAM
Pfam:Calpain_inhib 279 404 2.7e-36 PFAM
Pfam:Calpain_inhib 415 544 3.6e-38 PFAM
Pfam:Calpain_inhib 556 684 4.5e-36 PFAM
low complexity region 708 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169114
SMART Domains Protein: ENSMUSP00000133166
Gene: ENSMUSG00000021583

DomainStartEndE-ValueType
Pfam:Peptidase_M1 42 430 2.7e-135 PFAM
low complexity region 488 501 N/A INTRINSIC
Pfam:ERAP1_C 586 904 1.7e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000220738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221873
Predicted Effect probably null
Transcript: ENSMUST00000222588
Predicted Effect probably null
Transcript: ENSMUST00000223033
Predicted Effect probably null
Transcript: ENSMUST00000223126
Predicted Effect probably null
Transcript: ENSMUST00000223206
Predicted Effect probably null
Transcript: ENSMUST00000223309
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an inhibitor of the calcium-dependent cysteine protease, calpain. This protein plays roles in multiple processes, including apoptosis, cell cycle regulation, and membrane fusion. Multiple protein isoforms exist which contain unique N-terminal domains, and multiple inhibitory domains that share homology with each other. Some isoforms may be tissue-specific. Two different pseudogenes of this gene are found on chromosome 19. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knockout allele exhibit augmented DNA fragmentation in CA1 pyramidal neurons following excitotoxic kainate treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Cast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cast APN 13 74736974 missense probably damaging 1.00
IGL01363:Cast APN 13 74704192 missense possibly damaging 0.95
IGL01404:Cast APN 13 74738287 nonsense probably null
IGL01893:Cast APN 13 74727289 nonsense probably null
IGL02139:Cast APN 13 74728365 missense possibly damaging 0.80
IGL02444:Cast APN 13 74739853 missense probably damaging 1.00
IGL02927:Cast APN 13 74736994 missense probably damaging 1.00
IGL02941:Cast APN 13 74700687 missense probably damaging 1.00
IGL02799:Cast UTSW 13 74736752 missense probably damaging 1.00
R0583:Cast UTSW 13 74713678 missense probably damaging 0.99
R2031:Cast UTSW 13 74798652 splice site probably null
R2256:Cast UTSW 13 74739905 missense probably damaging 0.99
R2509:Cast UTSW 13 74737616 missense probably benign 0.19
R3923:Cast UTSW 13 74728413 missense probably damaging 1.00
R4116:Cast UTSW 13 74724837 missense probably damaging 1.00
R4649:Cast UTSW 13 74746014 missense probably benign 0.25
R4651:Cast UTSW 13 74746014 missense probably benign 0.25
R4652:Cast UTSW 13 74746014 missense probably benign 0.25
R4653:Cast UTSW 13 74746014 missense probably benign 0.25
R4714:Cast UTSW 13 74798715 missense probably damaging 1.00
R4751:Cast UTSW 13 74746047 missense probably damaging 1.00
R4758:Cast UTSW 13 74739880 missense possibly damaging 0.90
R4974:Cast UTSW 13 74807823 missense probably benign
R5040:Cast UTSW 13 74724813 missense probably damaging 1.00
R5397:Cast UTSW 13 74720937 missense possibly damaging 0.83
R5863:Cast UTSW 13 74736756 missense probably damaging 1.00
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6349:Cast UTSW 13 74721195 missense probably damaging 1.00
R6817:Cast UTSW 13 74699158 missense possibly damaging 0.78
R6829:Cast UTSW 13 74728344 missense possibly damaging 0.50
R6848:Cast UTSW 13 74695933 missense possibly damaging 0.66
R7275:Cast UTSW 13 74727334 missense probably benign 0.00
R7401:Cast UTSW 13 74808458 missense unknown
R7408:Cast UTSW 13 74739841 missense probably damaging 0.99
R7602:Cast UTSW 13 74736965 missense probably benign 0.26
R8032:Cast UTSW 13 74735241 nonsense probably null
X0011:Cast UTSW 13 74725456 missense probably damaging 1.00
X0066:Cast UTSW 13 74736979 missense probably damaging 1.00
Z1177:Cast UTSW 13 74725463 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAATAAGCCCTTTAGTGCTTGTTG -3'
(R):5'- CAGAGCATGTTTGTGTCAAATGAAG -3'

Sequencing Primer
(F):5'- GGGGAATGGAATACTTTGAACTTCGC -3'
(R):5'- TATAGACCAGGCCACCCTCTCTG -3'
Posted On2016-10-24