Incidental Mutation 'R5556:Pcdhb6'
List |< first << previous [record 39 of 56] next >> last >|
ID435416
Institutional Source Beutler Lab
Gene Symbol Pcdhb6
Ensembl Gene ENSMUSG00000051678
Gene Nameprotocadherin beta 6
SynonymsPcdhb5B, PcdhbF
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37333921-37337674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37334389 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 121 (L121Q)
Ref Sequence ENSEMBL: ENSMUSP00000058592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544] [ENSMUST00000194655]
Predicted Effect probably damaging
Transcript: ENSMUST00000061717
AA Change: L121Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678
AA Change: L121Q

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194655
SMART Domains Protein: ENSMUSP00000141773
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Blast:CA 1 60 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Pcdhb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pcdhb6 APN 18 37334224 missense probably damaging 1.00
IGL02123:Pcdhb6 APN 18 37335820 missense probably damaging 1.00
IGL02491:Pcdhb6 APN 18 37335682 missense probably damaging 1.00
IGL02496:Pcdhb6 APN 18 37335454 missense probably damaging 1.00
IGL02608:Pcdhb6 APN 18 37334694 missense probably damaging 0.99
IGL03130:Pcdhb6 APN 18 37335587 nonsense probably null
IGL03144:Pcdhb6 APN 18 37334406 missense probably damaging 1.00
IGL03189:Pcdhb6 APN 18 37336152 missense probably damaging 0.98
IGL03203:Pcdhb6 APN 18 37334532 missense possibly damaging 0.95
IGL03388:Pcdhb6 APN 18 37336137 missense probably damaging 0.99
PIT4445001:Pcdhb6 UTSW 18 37335247 missense possibly damaging 0.67
R0571:Pcdhb6 UTSW 18 37335114 missense probably benign 0.01
R0734:Pcdhb6 UTSW 18 37335334 missense probably damaging 0.99
R1727:Pcdhb6 UTSW 18 37334587 missense probably damaging 1.00
R2206:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2207:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2303:Pcdhb6 UTSW 18 37336231 missense probably damaging 1.00
R2401:Pcdhb6 UTSW 18 37335169 missense probably benign 0.35
R3409:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3411:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3625:Pcdhb6 UTSW 18 37336140 missense probably damaging 1.00
R3716:Pcdhb6 UTSW 18 37336206 missense probably benign 0.01
R4745:Pcdhb6 UTSW 18 37335373 missense possibly damaging 0.86
R4821:Pcdhb6 UTSW 18 37334328 missense probably damaging 1.00
R5218:Pcdhb6 UTSW 18 37334335 missense possibly damaging 0.95
R5465:Pcdhb6 UTSW 18 37334730 missense probably damaging 0.97
R5522:Pcdhb6 UTSW 18 37334349 missense probably benign
R5703:Pcdhb6 UTSW 18 37334700 missense probably benign 0.15
R6154:Pcdhb6 UTSW 18 37334913 missense probably benign 0.00
R6256:Pcdhb6 UTSW 18 37335925 missense probably damaging 0.98
R6304:Pcdhb6 UTSW 18 37335921 nonsense probably null
R6528:Pcdhb6 UTSW 18 37334503 missense probably damaging 1.00
R6883:Pcdhb6 UTSW 18 37335145 missense probably damaging 1.00
R7045:Pcdhb6 UTSW 18 37336276 missense possibly damaging 0.88
R7307:Pcdhb6 UTSW 18 37335478 missense probably benign
R7313:Pcdhb6 UTSW 18 37335208 missense probably damaging 0.99
R7378:Pcdhb6 UTSW 18 37335172 missense probably damaging 1.00
R7555:Pcdhb6 UTSW 18 37335279 missense possibly damaging 0.60
R7606:Pcdhb6 UTSW 18 37335606 missense probably damaging 0.99
R7701:Pcdhb6 UTSW 18 37334509 missense probably damaging 1.00
R7830:Pcdhb6 UTSW 18 37336312 missense probably benign 0.05
R7905:Pcdhb6 UTSW 18 37334554 missense probably benign 0.00
R7982:Pcdhb6 UTSW 18 37334220 nonsense probably null
R8818:Pcdhb6 UTSW 18 37335784 missense probably benign 0.06
Z1088:Pcdhb6 UTSW 18 37335146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGAAGGGCTCGAATCCATC -3'
(R):5'- CAGCTCTGGGTATTTCCTGC -3'

Sequencing Primer
(F):5'- GGCTCGAATCCATCACAGAGG -3'
(R):5'- CCATCTGAGCGACTGAGAGTAAC -3'
Posted On2016-10-24