Incidental Mutation 'R5556:Cndp2'
List |< first << previous [record 15 of 56] next >> last >|
ID435417
Institutional Source Beutler Lab
Gene Symbol Cndp2
Ensembl Gene ENSMUSG00000024644
Gene NameCNDP dipeptidase 2 (metallopeptidase M20 family)
SynonymsPep1, Dip-2, 0610010E05Rik, Cn2, Pep-1
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location84667470-84685633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84672124 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 231 (V231A)
Ref Sequence ENSEMBL: ENSMUSP00000128696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025546] [ENSMUST00000168419]
Predicted Effect probably benign
Transcript: ENSMUST00000025546
AA Change: V231A

PolyPhen 2 Score 0.384 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025546
Gene: ENSMUSG00000024644
AA Change: V231A

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.8e-35 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168419
AA Change: V231A

PolyPhen 2 Score 0.384 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128696
Gene: ENSMUSG00000024644
AA Change: V231A

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.2e-33 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNDP2, also known as tissue carnosinase and peptidase A (EC 3.4.13.18), is a nonspecific dipeptidase rather than a selective carnosinase (Teufel et al., 2003 [PubMed 12473676]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Cndp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Cndp2 APN 18 84677376 missense probably damaging 1.00
IGL01143:Cndp2 APN 18 84677317 critical splice donor site probably null
IGL01310:Cndp2 APN 18 84670877 missense possibly damaging 0.95
IGL01408:Cndp2 APN 18 84670911 missense probably benign
IGL01520:Cndp2 APN 18 84668607 missense probably benign 0.03
IGL02095:Cndp2 APN 18 84681032 missense possibly damaging 0.67
R1108:Cndp2 UTSW 18 84675060 missense probably damaging 1.00
R1264:Cndp2 UTSW 18 84678791 missense possibly damaging 0.88
R1466:Cndp2 UTSW 18 84677315 splice site probably benign
R1584:Cndp2 UTSW 18 84677315 splice site probably benign
R2363:Cndp2 UTSW 18 84668569 missense probably damaging 0.96
R2383:Cndp2 UTSW 18 84675090 missense possibly damaging 0.82
R3153:Cndp2 UTSW 18 84668597 missense probably benign 0.02
R4590:Cndp2 UTSW 18 84669808 missense probably damaging 1.00
R4788:Cndp2 UTSW 18 84675164 missense probably damaging 1.00
R5033:Cndp2 UTSW 18 84670829 missense possibly damaging 0.94
R5154:Cndp2 UTSW 18 84668602 missense probably benign 0.00
R5178:Cndp2 UTSW 18 84675028 missense probably benign 0.00
R5326:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5542:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5722:Cndp2 UTSW 18 84668078 nonsense probably null
R6431:Cndp2 UTSW 18 84675078 nonsense probably null
R6682:Cndp2 UTSW 18 84677330 missense probably benign 0.00
R7036:Cndp2 UTSW 18 84669945 missense possibly damaging 0.94
R7728:Cndp2 UTSW 18 84672077 missense probably benign 0.00
R7806:Cndp2 UTSW 18 84670820 missense probably benign
R8018:Cndp2 UTSW 18 84668602 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCCATGAAGGATGCTG -3'
(R):5'- TGTGCATGTGGTCTGCACATC -3'

Sequencing Primer
(F):5'- CTGGAACATACTAGGCACGTGC -3'
(R):5'- GGTCTGCACATCAGGAGTCTATC -3'
Posted On2016-10-24