Incidental Mutation 'R5556:Fibp'
List |< first << previous [record 24 of 56] next >> last >|
ID435418
Institutional Source Beutler Lab
Gene Symbol Fibp
Ensembl Gene ENSMUSG00000024911
Gene Namefibroblast growth factor (acidic) intracellular binding protein
Synonyms
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5460616-5465051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5464199 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 304 (V304E)
Ref Sequence ENSEMBL: ENSMUSP00000025847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025844] [ENSMUST00000025847] [ENSMUST00000225141]
Predicted Effect probably benign
Transcript: ENSMUST00000025844
SMART Domains Protein: ENSMUSP00000025844
Gene: ENSMUSG00000024910

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 40 97 2.21e-12 SMART
Pept_C1 126 357 1.58e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000025847
AA Change: V304E

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025847
Gene: ENSMUSG00000024911
AA Change: V304E

DomainStartEndE-ValueType
Pfam:FIBP 3 363 7.6e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224944
Predicted Effect possibly damaging
Transcript: ENSMUST00000225141
AA Change: V297E

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226017
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acidic fibroblast growth factor is mitogenic for a variety of different cell types and acts by stimulating mitogenesis or inducing morphological changes and differentiation. The FIBP protein is an intracellular protein that binds selectively to acidic fibroblast growth factor (aFGF). It is postulated that FIBP may be involved in the mitogenic action of aFGF. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Accs A G 2: 93,836,083 Y420H probably damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Fibp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02246:Fibp APN 19 5463236 missense probably damaging 1.00
R0539:Fibp UTSW 19 5463188 missense probably damaging 1.00
R1350:Fibp UTSW 19 5461391 missense probably damaging 1.00
R1708:Fibp UTSW 19 5463794 missense probably null 1.00
R4021:Fibp UTSW 19 5460734 splice site probably null
R5915:Fibp UTSW 19 5463616 missense possibly damaging 0.92
R5932:Fibp UTSW 19 5464425 missense probably benign 0.01
R7083:Fibp UTSW 19 5463631 missense probably damaging 1.00
R7131:Fibp UTSW 19 5461491 missense probably damaging 0.97
R7762:Fibp UTSW 19 5464174 missense probably benign 0.12
R8465:Fibp UTSW 19 5463187 missense probably damaging 1.00
R8758:Fibp UTSW 19 5464942 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTCCTGAAGGTGACCAGCAG -3'
(R):5'- ACATCACTCAGTGGCCAGTG -3'

Sequencing Primer
(F):5'- GGGGTCCCAAGCTCATAAC -3'
(R):5'- ACTCAGTGGCCAGTGGTCAG -3'
Posted On2016-10-24