Incidental Mutation 'R5557:Kcnq2'
ID435438
Institutional Source Beutler Lab
Gene Symbol Kcnq2
Ensembl Gene ENSMUSG00000016346
Gene Namepotassium voltage-gated channel, subfamily Q, member 2
SynonymsKQT2, Nmf134
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5557 (G1)
Quality Score130
Status Validated
Chromosome2
Chromosomal Location181075579-181135300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181134897 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 66 (K66E)
Ref Sequence ENSEMBL: ENSMUSP00000099340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016491] [ENSMUST00000049792] [ENSMUST00000081528] [ENSMUST00000103047] [ENSMUST00000103048] [ENSMUST00000103050] [ENSMUST00000103051] [ENSMUST00000149964] [ENSMUST00000197015]
Predicted Effect probably benign
Transcript: ENSMUST00000016491
AA Change: K66E

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000016491
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.3e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 595 2e-59 PFAM
Pfam:KCNQ_channel 593 673 1.7e-22 PFAM
low complexity region 711 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049792
AA Change: K66E

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052453
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.2e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 565 3.1e-55 PFAM
Pfam:KCNQ_channel 587 668 6.8e-23 PFAM
low complexity region 706 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081528
AA Change: K66E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080243
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 4.3e-29 PFAM
Pfam:Ion_trans_2 237 317 1.7e-14 PFAM
Pfam:KCNQ_channel 436 564 2.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103047
AA Change: K66E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099336
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.1e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 424 583 2e-59 PFAM
Pfam:KCNQ_channel 581 661 1.7e-22 PFAM
low complexity region 699 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103048
AA Change: K66E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099337
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 6.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.4e-14 PFAM
Pfam:KCNQ_channel 436 637 1.3e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000103049
AA Change: K9E
SMART Domains Protein: ENSMUSP00000099338
Gene: ENSMUSG00000016346
AA Change: K9E

DomainStartEndE-ValueType
Pfam:Ion_trans 35 268 3.7e-32 PFAM
Pfam:Ion_trans_2 181 261 1.1e-14 PFAM
Pfam:KCNQ_channel 392 584 1e-92 PFAM
Pfam:KCNQ2_u3 591 679 3.9e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 692 791 1.1e-48 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103050
AA Change: K66E
SMART Domains Protein: ENSMUSP00000099339
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103051
AA Change: K66E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099340
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.9e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 446 647 1.7e-82 PFAM
low complexity region 685 697 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 747 849 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123336
SMART Domains Protein: ENSMUSP00000130700
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 2.2e-30 PFAM
Pfam:Ion_trans_2 237 317 1.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129073
SMART Domains Protein: ENSMUSP00000127061
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 1e-28 PFAM
Pfam:Ion_trans_2 237 317 3.4e-14 PFAM
Pfam:KCNQ_channel 436 565 3e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129361
SMART Domains Protein: ENSMUSP00000131756
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 310 7.6e-29 PFAM
Pfam:Ion_trans_2 237 311 2.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140789
Predicted Effect probably benign
Transcript: ENSMUST00000149964
AA Change: K66E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122915
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
Pfam:Ion_trans 91 324 4.4e-32 PFAM
Pfam:Ion_trans_2 237 317 1.3e-14 PFAM
low complexity region 418 431 N/A INTRINSIC
Pfam:KCNQ_channel 466 659 6.2e-94 PFAM
Pfam:KCNQ2_u3 666 754 4.5e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 767 866 1.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139458
SMART Domains Protein: ENSMUSP00000130633
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
Pfam:Ion_trans 91 324 2.6e-32 PFAM
Pfam:Ion_trans_2 237 317 9.7e-15 PFAM
low complexity region 408 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144592
SMART Domains Protein: ENSMUSP00000133237
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 5.6e-29 PFAM
Pfam:Ion_trans_2 237 317 2.2e-14 PFAM
low complexity region 398 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154164
SMART Domains Protein: ENSMUSP00000131544
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 1.4e-29 PFAM
Pfam:Ion_trans_2 237 317 7.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197015
AA Change: K66E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143263
Gene: ENSMUSG00000016346
AA Change: K66E

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Meta Mutation Damage Score 0.1471 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die perinatally with pulmonary atelectasis. Heterozygous mice exhibit a hypersensitivity to the epileptic inducer pentylenetetrazole. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Kcnq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Kcnq2 APN 2 181109789 unclassified probably benign
IGL02064:Kcnq2 APN 2 181109026 missense probably damaging 1.00
IGL02231:Kcnq2 APN 2 181081715 missense probably benign 0.22
IGL02261:Kcnq2 APN 2 181081690 missense probably damaging 0.98
IGL02510:Kcnq2 APN 2 181081361 missense probably benign
IGL02583:Kcnq2 APN 2 181081502 missense probably benign 0.01
IGL02627:Kcnq2 APN 2 181082327 unclassified probably benign
IGL03303:Kcnq2 APN 2 181082389 missense probably benign
R0269:Kcnq2 UTSW 2 181096974 missense probably benign 0.00
R1535:Kcnq2 UTSW 2 181134825 missense probably damaging 1.00
R1688:Kcnq2 UTSW 2 181087033 missense probably damaging 1.00
R1776:Kcnq2 UTSW 2 181100557 missense probably benign 0.01
R1946:Kcnq2 UTSW 2 181088451 missense probably benign 0.09
R2105:Kcnq2 UTSW 2 181081352 missense probably benign 0.03
R2382:Kcnq2 UTSW 2 181112107 missense probably damaging 1.00
R2912:Kcnq2 UTSW 2 181081774 missense probably damaging 1.00
R3826:Kcnq2 UTSW 2 181104900 missense possibly damaging 0.56
R3898:Kcnq2 UTSW 2 181109686 missense probably damaging 0.97
R4282:Kcnq2 UTSW 2 181081153 missense probably damaging 1.00
R4938:Kcnq2 UTSW 2 181086973 missense probably damaging 0.96
R4962:Kcnq2 UTSW 2 181112043 missense possibly damaging 0.59
R5055:Kcnq2 UTSW 2 181086761 intron probably benign
R5107:Kcnq2 UTSW 2 181108547 intron probably benign
R5371:Kcnq2 UTSW 2 181135020 missense probably damaging 1.00
R5839:Kcnq2 UTSW 2 181109751 missense probably damaging 1.00
R5998:Kcnq2 UTSW 2 181087008 missense probably damaging 1.00
R6084:Kcnq2 UTSW 2 181087656 missense possibly damaging 0.53
R6207:Kcnq2 UTSW 2 181113233 missense possibly damaging 0.49
R6744:Kcnq2 UTSW 2 181085306 missense possibly damaging 0.94
R7018:Kcnq2 UTSW 2 181081724 nonsense probably null
R7266:Kcnq2 UTSW 2 181135092 start codon destroyed probably null 0.92
R7291:Kcnq2 UTSW 2 181088379 missense possibly damaging 0.69
R7319:Kcnq2 UTSW 2 181109102 missense probably damaging 1.00
R7447:Kcnq2 UTSW 2 181113094 missense probably damaging 0.97
R7573:Kcnq2 UTSW 2 181081589 missense probably benign 0.04
R7897:Kcnq2 UTSW 2 181081141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAACCCGAGACTGCAATGC -3'
(R):5'- CAATGGCGTCGTAGGGGTTAAG -3'

Sequencing Primer
(F):5'- GAGACTGCAATGCCACGAC -3'
(R):5'- ACCATGGTGCAGAAGTCGC -3'
Posted On2016-10-24