Incidental Mutation 'R5557:Ncbp1'
ID 435441
Institutional Source Beutler Lab
Gene Symbol Ncbp1
Ensembl Gene ENSMUSG00000028330
Gene Name nuclear cap binding protein subunit 1
Synonyms
MMRRC Submission 043114-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5557 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 46138613-46172403 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46165259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 524 (V524A)
Ref Sequence ENSEMBL: ENSMUSP00000030014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030014] [ENSMUST00000058232]
AlphaFold Q3UYV9
PDB Structure Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030014
AA Change: V524A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: V524A

DomainStartEndE-ValueType
MIF4G 28 240 1.33e-38 SMART
Pfam:MIF4G_like 309 471 1.4e-37 PFAM
Pfam:MIF4G_like_2 485 754 4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058232
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133286
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,767,501 (GRCm39) F363I possibly damaging Het
Abcb1a T A 5: 8,764,949 (GRCm39) N646K probably benign Het
Abi2 C A 1: 60,478,071 (GRCm39) probably benign Het
Adamts13 T C 2: 26,863,651 (GRCm39) S35P probably benign Het
B4galt3 A G 1: 171,100,089 (GRCm39) probably null Het
Bag5 T C 12: 111,676,524 (GRCm39) N433S probably benign Het
Birc7 T A 2: 180,574,772 (GRCm39) V218D probably benign Het
Catsperg1 T G 7: 28,895,296 (GRCm39) N332T possibly damaging Het
Ccdc191 A C 16: 43,728,976 (GRCm39) T179P probably damaging Het
Col4a3 C T 1: 82,692,968 (GRCm39) probably benign Het
Crlf1 A G 8: 70,951,317 (GRCm39) I65M probably benign Het
Dennd4a T G 9: 64,811,509 (GRCm39) D1376E probably benign Het
Dennd4b G A 3: 90,175,675 (GRCm39) R148Q probably damaging Het
Dlg4 C T 11: 69,933,106 (GRCm39) P504L probably damaging Het
Dop1b A G 16: 93,560,819 (GRCm39) T886A probably damaging Het
Dst T A 1: 34,321,667 (GRCm39) V4394E probably damaging Het
Endov T C 11: 119,393,186 (GRCm39) M112T possibly damaging Het
Eps8 T C 6: 137,456,094 (GRCm39) M796V possibly damaging Het
Fam107b T A 2: 3,771,791 (GRCm39) Y7* probably null Het
Farsb C T 1: 78,445,888 (GRCm39) probably null Het
Fasn A G 11: 120,703,252 (GRCm39) M1591T probably benign Het
Fbn2 C T 18: 58,248,731 (GRCm39) A384T probably benign Het
Fnta T C 8: 26,489,564 (GRCm39) D349G probably damaging Het
Glis3 G T 19: 28,241,409 (GRCm39) H842N probably benign Het
Gm17067 G A 7: 42,357,945 (GRCm39) P186S probably damaging Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hk3 A T 13: 55,159,888 (GRCm39) L362* probably null Het
Ing3 A G 6: 21,968,908 (GRCm39) H130R possibly damaging Het
Inpp4b A T 8: 82,678,888 (GRCm39) Q306L probably damaging Het
Kcnq2 T C 2: 180,776,690 (GRCm39) K66E probably benign Het
Kif21b C A 1: 136,097,797 (GRCm39) N1352K probably damaging Het
Lrig3 A T 10: 125,808,003 (GRCm39) N84Y probably damaging Het
Mill2 T A 7: 18,589,884 (GRCm39) Y55* probably null Het
Mmachc T C 4: 116,563,097 (GRCm39) H86R probably damaging Het
Or10ag54 A T 2: 87,099,736 (GRCm39) T204S possibly damaging Het
Or1q1 T A 2: 36,887,358 (GRCm39) C179S probably damaging Het
Or4c102 G A 2: 88,422,897 (GRCm39) V250M probably damaging Het
Or5af1 G A 11: 58,722,813 (GRCm39) V278I probably benign Het
Or5b101 C A 19: 13,005,004 (GRCm39) A230S probably benign Het
Or7g19 T C 9: 18,856,466 (GRCm39) I174T possibly damaging Het
Pigu G T 2: 155,120,549 (GRCm39) Y404* probably null Het
Plaa A T 4: 94,472,244 (GRCm39) probably null Het
Plcg2 A T 8: 118,313,296 (GRCm39) I487F probably damaging Het
Plekhh2 T C 17: 84,867,580 (GRCm39) I162T probably benign Het
Ptprz1 T A 6: 23,001,000 (GRCm39) V1030D probably benign Het
Raver2 C A 4: 100,993,336 (GRCm39) S505R probably benign Het
Samd7 A T 3: 30,810,769 (GRCm39) Q262L probably benign Het
Scn9a T A 2: 66,377,447 (GRCm39) N412Y probably damaging Het
Sytl1 C A 4: 132,986,667 (GRCm39) R91M probably damaging Het
Tead3 A T 17: 28,555,244 (GRCm39) probably benign Het
Tgm1 A G 14: 55,943,100 (GRCm39) M580T probably benign Het
Themis A T 10: 28,657,882 (GRCm39) Q150L possibly damaging Het
Tmem213 T C 6: 38,086,466 (GRCm39) S41P possibly damaging Het
Tnks1bp1 T C 2: 84,894,144 (GRCm39) V695A probably damaging Het
Trim23 A T 13: 104,324,017 (GRCm39) T159S probably damaging Het
Trim66 T C 7: 109,082,944 (GRCm39) Y166C probably benign Het
Troap A T 15: 98,973,675 (GRCm39) T111S possibly damaging Het
Ttn T C 2: 76,720,734 (GRCm39) probably null Het
Tub T G 7: 108,624,925 (GRCm39) S180A probably damaging Het
Vcan A G 13: 89,851,231 (GRCm39) V1243A possibly damaging Het
Zfp608 T C 18: 55,120,942 (GRCm39) D215G possibly damaging Het
Zfp638 T A 6: 83,944,345 (GRCm39) V1021E probably damaging Het
Zim1 T A 7: 6,680,710 (GRCm39) I318F probably damaging Het
Other mutations in Ncbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Ncbp1 APN 4 46,161,307 (GRCm39) missense probably damaging 1.00
IGL02085:Ncbp1 APN 4 46,159,699 (GRCm39) missense probably damaging 0.96
IGL02230:Ncbp1 APN 4 46,165,272 (GRCm39) missense probably benign 0.03
IGL02561:Ncbp1 APN 4 46,159,711 (GRCm39) missense possibly damaging 0.80
IGL02574:Ncbp1 APN 4 46,168,449 (GRCm39) critical splice acceptor site probably null
IGL03371:Ncbp1 APN 4 46,171,991 (GRCm39) nonsense probably null
R0549:Ncbp1 UTSW 4 46,168,476 (GRCm39) missense possibly damaging 0.69
R0594:Ncbp1 UTSW 4 46,170,551 (GRCm39) missense probably benign 0.00
R0699:Ncbp1 UTSW 4 46,147,528 (GRCm39) missense probably benign 0.17
R0725:Ncbp1 UTSW 4 46,152,056 (GRCm39) missense probably benign 0.01
R0961:Ncbp1 UTSW 4 46,165,193 (GRCm39) missense possibly damaging 0.69
R1330:Ncbp1 UTSW 4 46,167,354 (GRCm39) missense probably benign 0.19
R1622:Ncbp1 UTSW 4 46,171,963 (GRCm39) missense possibly damaging 0.60
R1756:Ncbp1 UTSW 4 46,169,131 (GRCm39) nonsense probably null
R2417:Ncbp1 UTSW 4 46,168,530 (GRCm39) missense probably benign 0.20
R4050:Ncbp1 UTSW 4 46,147,483 (GRCm39) missense probably damaging 0.99
R4132:Ncbp1 UTSW 4 46,169,241 (GRCm39) nonsense probably null
R4516:Ncbp1 UTSW 4 46,157,824 (GRCm39) missense probably damaging 1.00
R4795:Ncbp1 UTSW 4 46,152,967 (GRCm39) missense possibly damaging 0.83
R4796:Ncbp1 UTSW 4 46,152,967 (GRCm39) missense possibly damaging 0.83
R4960:Ncbp1 UTSW 4 46,165,273 (GRCm39) nonsense probably null
R5626:Ncbp1 UTSW 4 46,161,290 (GRCm39) missense probably damaging 1.00
R5682:Ncbp1 UTSW 4 46,170,474 (GRCm39) unclassified probably benign
R5859:Ncbp1 UTSW 4 46,163,026 (GRCm39) missense probably benign 0.00
R6377:Ncbp1 UTSW 4 46,150,703 (GRCm39) missense probably damaging 1.00
R6440:Ncbp1 UTSW 4 46,147,516 (GRCm39) missense probably damaging 1.00
R6793:Ncbp1 UTSW 4 46,157,827 (GRCm39) missense probably damaging 0.99
R7078:Ncbp1 UTSW 4 46,155,756 (GRCm39) missense probably benign 0.00
R7434:Ncbp1 UTSW 4 46,149,910 (GRCm39) missense probably damaging 1.00
R7445:Ncbp1 UTSW 4 46,149,914 (GRCm39) missense probably damaging 0.98
R7477:Ncbp1 UTSW 4 46,157,897 (GRCm39) missense probably damaging 1.00
R7670:Ncbp1 UTSW 4 46,170,015 (GRCm39) missense probably damaging 0.96
R8424:Ncbp1 UTSW 4 46,144,839 (GRCm39) missense probably benign
R8970:Ncbp1 UTSW 4 46,170,023 (GRCm39) missense probably damaging 0.99
R9712:Ncbp1 UTSW 4 46,144,837 (GRCm39) missense probably benign 0.03
X0013:Ncbp1 UTSW 4 46,150,702 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTGATCTTGGGCTGAAGTATGC -3'
(R):5'- TCCCCAGGAATTTTAGGGCCTC -3'

Sequencing Primer
(F):5'- GCTGAAGTATGCTGTTTTAAAAGG -3'
(R):5'- CCCAGGAATTTTAGGGCCTCTTAGG -3'
Posted On 2016-10-24