Incidental Mutation 'R5557:Ncbp1'
ID435441
Institutional Source Beutler Lab
Gene Symbol Ncbp1
Ensembl Gene ENSMUSG00000028330
Gene Namenuclear cap binding protein subunit 1
Synonyms
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5557 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46138613-46172403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46165259 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 524 (V524A)
Ref Sequence ENSEMBL: ENSMUSP00000030014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030014] [ENSMUST00000058232]
PDB Structure
Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030014
AA Change: V524A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: V524A

DomainStartEndE-ValueType
MIF4G 28 240 1.33e-38 SMART
Pfam:MIF4G_like 309 471 1.4e-37 PFAM
Pfam:MIF4G_like_2 485 754 4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058232
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133286
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Ncbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Ncbp1 APN 4 46161307 missense probably damaging 1.00
IGL02085:Ncbp1 APN 4 46159699 missense probably damaging 0.96
IGL02230:Ncbp1 APN 4 46165272 missense probably benign 0.03
IGL02561:Ncbp1 APN 4 46159711 missense possibly damaging 0.80
IGL02574:Ncbp1 APN 4 46168449 critical splice acceptor site probably null
IGL03371:Ncbp1 APN 4 46171991 nonsense probably null
R0549:Ncbp1 UTSW 4 46168476 missense possibly damaging 0.69
R0594:Ncbp1 UTSW 4 46170551 missense probably benign 0.00
R0699:Ncbp1 UTSW 4 46147528 missense probably benign 0.17
R0725:Ncbp1 UTSW 4 46152056 missense probably benign 0.01
R0961:Ncbp1 UTSW 4 46165193 missense possibly damaging 0.69
R1330:Ncbp1 UTSW 4 46167354 missense probably benign 0.19
R1622:Ncbp1 UTSW 4 46171963 missense possibly damaging 0.60
R1756:Ncbp1 UTSW 4 46169131 nonsense probably null
R2417:Ncbp1 UTSW 4 46168530 missense probably benign 0.20
R4050:Ncbp1 UTSW 4 46147483 missense probably damaging 0.99
R4132:Ncbp1 UTSW 4 46169241 nonsense probably null
R4516:Ncbp1 UTSW 4 46157824 missense probably damaging 1.00
R4795:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4796:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4960:Ncbp1 UTSW 4 46165273 nonsense probably null
R5626:Ncbp1 UTSW 4 46161290 missense probably damaging 1.00
R5682:Ncbp1 UTSW 4 46170474 unclassified probably benign
R5859:Ncbp1 UTSW 4 46163026 missense probably benign 0.00
R6377:Ncbp1 UTSW 4 46150703 missense probably damaging 1.00
R6440:Ncbp1 UTSW 4 46147516 missense probably damaging 1.00
R6793:Ncbp1 UTSW 4 46157827 missense probably damaging 0.99
R7078:Ncbp1 UTSW 4 46155756 missense probably benign 0.00
R7434:Ncbp1 UTSW 4 46149910 missense probably damaging 1.00
R7445:Ncbp1 UTSW 4 46149914 missense probably damaging 0.98
R7477:Ncbp1 UTSW 4 46157897 missense probably damaging 1.00
R7670:Ncbp1 UTSW 4 46170015 missense probably damaging 0.96
X0013:Ncbp1 UTSW 4 46150702 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTGATCTTGGGCTGAAGTATGC -3'
(R):5'- TCCCCAGGAATTTTAGGGCCTC -3'

Sequencing Primer
(F):5'- GCTGAAGTATGCTGTTTTAAAAGG -3'
(R):5'- CCCAGGAATTTTAGGGCCTCTTAGG -3'
Posted On2016-10-24