Incidental Mutation 'R5557:Plaa'
ID435442
Institutional Source Beutler Lab
Gene Symbol Plaa
Ensembl Gene ENSMUSG00000028577
Gene Namephospholipase A2, activating protein
SynonymsD4Ertd618e, Ufd3
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5557 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location94567514-94603244 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 94584007 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000107107] [ENSMUST00000107107]
Predicted Effect probably null
Transcript: ENSMUST00000107107
SMART Domains Protein: ENSMUSP00000102724
Gene: ENSMUSG00000028577

DomainStartEndE-ValueType
WD40 7 47 4.46e-1 SMART
WD40 54 98 8.49e-3 SMART
WD40 101 139 1.72e-3 SMART
WD40 140 179 8.81e-10 SMART
WD40 180 218 3.22e-3 SMART
WD40 220 259 7.33e-7 SMART
WD40 260 298 6.79e-2 SMART
Pfam:PFU 345 459 2.3e-43 PFAM
Pfam:PUL 535 789 1.4e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107107
SMART Domains Protein: ENSMUSP00000102724
Gene: ENSMUSG00000028577

DomainStartEndE-ValueType
WD40 7 47 4.46e-1 SMART
WD40 54 98 8.49e-3 SMART
WD40 101 139 1.72e-3 SMART
WD40 140 179 8.81e-10 SMART
WD40 180 218 3.22e-3 SMART
WD40 220 259 7.33e-7 SMART
WD40 260 298 6.79e-2 SMART
Pfam:PFU 345 459 2.3e-43 PFAM
Pfam:PUL 535 789 1.4e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127656
SMART Domains Protein: ENSMUSP00000116530
Gene: ENSMUSG00000028577

DomainStartEndE-ValueType
Pfam:PFU 1 89 2.6e-34 PFAM
Pfam:PUL 142 214 7.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136669
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Homozygous KO is embryonic lethal. A hypomorphic homozygous point mutation affects neuromuscular junctions and Purkinje cell development, causing early-onset neurodysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Plaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Plaa APN 4 94582607 missense probably benign 0.00
IGL01089:Plaa APN 4 94574047 missense probably benign
IGL01695:Plaa APN 4 94574037 nonsense probably null
IGL01984:Plaa APN 4 94571685 splice site probably null
IGL02430:Plaa APN 4 94582573 missense probably benign 0.09
IGL02552:Plaa APN 4 94582480 critical splice donor site probably null
IGL03238:Plaa APN 4 94583896 missense probably benign 0.23
R1353:Plaa UTSW 4 94571689 missense possibly damaging 0.69
R2937:Plaa UTSW 4 94569459 missense probably damaging 1.00
R3076:Plaa UTSW 4 94569805 missense probably benign
R3078:Plaa UTSW 4 94569805 missense probably benign
R3801:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3802:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3804:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3836:Plaa UTSW 4 94586922 critical splice acceptor site probably null
R4767:Plaa UTSW 4 94586258 unclassified probably benign
R4855:Plaa UTSW 4 94586408 missense probably damaging 1.00
R4978:Plaa UTSW 4 94589932 missense possibly damaging 0.81
R5284:Plaa UTSW 4 94569637 missense probably benign 0.03
R5834:Plaa UTSW 4 94583469 missense probably damaging 1.00
R5856:Plaa UTSW 4 94583487 missense probably benign 0.00
R6053:Plaa UTSW 4 94589884 missense probably benign 0.00
R6145:Plaa UTSW 4 94583992 missense probably damaging 0.99
R6646:Plaa UTSW 4 94589978 missense probably benign
R7008:Plaa UTSW 4 94569349 makesense probably null
R7058:Plaa UTSW 4 94569823 nonsense probably null
R7078:Plaa UTSW 4 94574051 missense probably benign
R7120:Plaa UTSW 4 94582682 missense possibly damaging 0.91
R7651:Plaa UTSW 4 94582639 missense probably damaging 1.00
R8163:Plaa UTSW 4 94569403 missense probably benign 0.01
R8188:Plaa UTSW 4 94586349 missense probably damaging 1.00
R8354:Plaa UTSW 4 94569477 missense probably damaging 1.00
R8454:Plaa UTSW 4 94569477 missense probably damaging 1.00
R8838:Plaa UTSW 4 94583554 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GCTCACTGAGATGTTCCCTC -3'
(R):5'- AGGCTAATGGACACAAGGTTC -3'

Sequencing Primer
(F):5'- TGAGATGTTCCCTCCCAGGAAG -3'
(R):5'- CTAATGGACACAAGGTTCTGATG -3'
Posted On2016-10-24