Incidental Mutation 'R5557:Fnta'
ID435460
Institutional Source Beutler Lab
Gene Symbol Fnta
Ensembl Gene ENSMUSG00000015994
Gene Namefarnesyltransferase, CAAX box, alpha
SynonymsFTA
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5557 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25998722-26015650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25999536 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 349 (D349G)
Ref Sequence ENSEMBL: ENSMUSP00000016138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016138]
PDB Structure
Crystal structure of FTase(ALPHA-subunit; BETA-subunit DELTA C10) in complex with BMS3 and lipid substrate FPP [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000016138
AA Change: D349G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016138
Gene: ENSMUSG00000015994
AA Change: D349G

DomainStartEndE-ValueType
low complexity region 11 48 N/A INTRINSIC
Pfam:PPTA 116 143 4.6e-11 PFAM
Pfam:PPTA 151 178 9.2e-14 PFAM
Pfam:PPTA 185 212 3.9e-15 PFAM
Pfam:PPTA 219 246 8.1e-11 PFAM
Pfam:PPTA 259 285 4.7e-9 PFAM
low complexity region 293 304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211718
Meta Mutation Damage Score 0.9328 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Fnta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fnta APN 8 26007201 nonsense probably null
IGL01508:Fnta APN 8 26007266 missense probably damaging 1.00
R0455:Fnta UTSW 8 26001028 missense probably benign 0.00
R1462:Fnta UTSW 8 25999571 splice site probably null
R1462:Fnta UTSW 8 25999571 splice site probably null
R1772:Fnta UTSW 8 26000966 splice site probably benign
R2095:Fnta UTSW 8 25999879 nonsense probably null
R2174:Fnta UTSW 8 26013470 missense possibly damaging 0.95
R5193:Fnta UTSW 8 26011218 splice site probably null
R5212:Fnta UTSW 8 26009707 missense probably benign 0.07
R5756:Fnta UTSW 8 26009707 missense possibly damaging 0.94
R6467:Fnta UTSW 8 26007313 nonsense probably null
R7127:Fnta UTSW 8 26007203 missense probably damaging 1.00
R7571:Fnta UTSW 8 26015465 missense probably benign 0.02
R7644:Fnta UTSW 8 26013488 missense probably damaging 0.97
R8012:Fnta UTSW 8 25999507 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTTGTTAAAAGCAGCACCTGG -3'
(R):5'- ACCTCATGGAGTTTCTCAGGG -3'

Sequencing Primer
(F):5'- AGCACCTGGACAGCTTTAG -3'
(R):5'- CATGGAGTTTCTCAGGGCTCTTTC -3'
Posted On2016-10-24