Incidental Mutation 'R5557:Gprc5c'
ID435470
Institutional Source Beutler Lab
Gene Symbol Gprc5c
Ensembl Gene ENSMUSG00000051043
Gene NameG protein-coupled receptor, family C, group 5, member C
Synonyms
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5557 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location114851152-114872617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114864267 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 257 (V257L)
Ref Sequence ENSEMBL: ENSMUSP00000061760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 60 301 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122967
SMART Domains Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133245
SMART Domains Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 283 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142262
SMART Domains Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 133 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152314
Predicted Effect possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Gprc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Gprc5c APN 11 114864252 missense probably benign 0.01
IGL01762:Gprc5c APN 11 114864024 missense probably benign 0.28
IGL02039:Gprc5c APN 11 114864486 nonsense probably null
R0800:Gprc5c UTSW 11 114866711 missense probably damaging 0.99
R1618:Gprc5c UTSW 11 114864394 missense possibly damaging 0.88
R4198:Gprc5c UTSW 11 114863860 missense probably damaging 1.00
R4807:Gprc5c UTSW 11 114864498 missense probably damaging 0.97
R4846:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4902:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4904:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5016:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5048:Gprc5c UTSW 11 114870351 makesense probably null
R5106:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5109:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5173:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5266:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5267:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5475:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5508:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5562:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5563:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5598:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5599:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5729:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5756:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5792:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5793:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5794:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5817:Gprc5c UTSW 11 114863624 nonsense probably null
R5976:Gprc5c UTSW 11 114864487 missense possibly damaging 0.89
R6151:Gprc5c UTSW 11 114864025 missense probably damaging 1.00
R6617:Gprc5c UTSW 11 114864105 missense probably benign 0.05
R7108:Gprc5c UTSW 11 114864282 missense probably damaging 1.00
R7191:Gprc5c UTSW 11 114868617 missense possibly damaging 0.56
R7796:Gprc5c UTSW 11 114864532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- CTTCAGGATGGTCTCATAGCCC -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- GGGTACATGTCCCCCTGGTAG -3'
Posted On2016-10-24