Incidental Mutation 'R5557:Bag5'
ID435472
Institutional Source Beutler Lab
Gene Symbol Bag5
Ensembl Gene ENSMUSG00000049792
Gene NameBCL2-associated athanogene 5
Synonyms
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R5557 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111709488-111713257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111710090 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 433 (N433S)
Ref Sequence ENSEMBL: ENSMUSP00000125183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040519] [ENSMUST00000054636] [ENSMUST00000159557] [ENSMUST00000160576] [ENSMUST00000160825] [ENSMUST00000162316] [ENSMUST00000162953] [ENSMUST00000163220]
Predicted Effect probably benign
Transcript: ENSMUST00000040519
SMART Domains Protein: ENSMUSP00000038865
Gene: ENSMUSG00000037787

DomainStartEndE-ValueType
Pfam:DUF2315 54 182 5.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054636
AA Change: N433S

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051049
Gene: ENSMUSG00000049792
AA Change: N433S

DomainStartEndE-ValueType
BAG 9 86 6.38e-21 SMART
Blast:BAG 101 165 2e-13 BLAST
BAG 182 260 6.94e-22 SMART
BAG 275 350 2.65e-18 SMART
BAG 365 442 9.88e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159557
Predicted Effect probably benign
Transcript: ENSMUST00000160576
AA Change: N433S

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125183
Gene: ENSMUSG00000049792
AA Change: N433S

DomainStartEndE-ValueType
BAG 9 86 6.38e-21 SMART
Blast:BAG 101 165 2e-13 BLAST
BAG 182 260 6.94e-22 SMART
BAG 275 350 2.65e-18 SMART
BAG 365 442 9.88e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160825
SMART Domains Protein: ENSMUSP00000123839
Gene: ENSMUSG00000049792

DomainStartEndE-ValueType
Pfam:BAG 12 60 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162316
SMART Domains Protein: ENSMUSP00000125711
Gene: ENSMUSG00000037787

DomainStartEndE-ValueType
Pfam:DUF2315 53 130 7.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162953
Predicted Effect probably benign
Transcript: ENSMUST00000163220
SMART Domains Protein: ENSMUSP00000131169
Gene: ENSMUSG00000037787

DomainStartEndE-ValueType
Pfam:DUF2315 54 162 3.7e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221152
Meta Mutation Damage Score 0.1349 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hk3 A T 13: 55,012,075 L362* probably null Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Bag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Bag5 APN 12 111711332 missense probably damaging 1.00
R2863:Bag5 UTSW 12 111710595 missense probably benign 0.02
R7443:Bag5 UTSW 12 111710727 missense probably damaging 0.99
R7501:Bag5 UTSW 12 111710288 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTTTGCAACATCAAAAGCAG -3'
(R):5'- AAGCTGTTCCCATGTGAGGAG -3'

Sequencing Primer
(F):5'- TGCAACATCAAAAGCAGCAGAAATAC -3'
(R):5'- TGGGAGATCCTTGGGAACC -3'
Posted On2016-10-24