Incidental Mutation 'R5557:Hk3'
ID435473
Institutional Source Beutler Lab
Gene Symbol Hk3
Ensembl Gene ENSMUSG00000025877
Gene Namehexokinase 3
Synonyms
MMRRC Submission 043114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5557 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55005985-55021385 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 55012075 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 362 (L362*)
Ref Sequence ENSEMBL: ENSMUSP00000115227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052949] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000148221] [ENSMUST00000153665]
Predicted Effect probably null
Transcript: ENSMUST00000052949
AA Change: L417*
SMART Domains Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877
AA Change: L417*

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.7e-76 PFAM
Pfam:Hexokinase_2 234 473 1.9e-87 PFAM
Pfam:Hexokinase_1 475 674 2.2e-77 PFAM
Pfam:Hexokinase_2 676 915 2.3e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123097
AA Change: L417*
SMART Domains Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877
AA Change: L417*

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.3e-77 PFAM
Pfam:Hexokinase_2 234 457 6e-74 PFAM
Pfam:Hexokinase_1 430 629 3e-78 PFAM
Pfam:Hexokinase_2 631 870 1e-104 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126234
AA Change: L417*
SMART Domains Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877
AA Change: L417*

DomainStartEndE-ValueType
Pfam:Hexokinase_1 31 230 2.4e-63 PFAM
Pfam:Hexokinase_2 236 470 2.9e-62 PFAM
Pfam:Hexokinase_1 480 673 2e-69 PFAM
Pfam:Hexokinase_2 678 912 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132309
SMART Domains Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 164 4.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135983
Predicted Effect probably benign
Transcript: ENSMUST00000148221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149644
Predicted Effect probably null
Transcript: ENSMUST00000153665
AA Change: L362*
SMART Domains Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877
AA Change: L362*

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 177 8.5e-70 PFAM
Pfam:Hexokinase_2 179 418 9.4e-88 PFAM
Pfam:Hexokinase_1 420 619 1.2e-77 PFAM
Pfam:Hexokinase_2 621 860 1.1e-103 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,717,501 F363I possibly damaging Het
Abcb1a T A 5: 8,714,949 N646K probably benign Het
Abi2 C A 1: 60,438,912 probably benign Het
Adamts13 T C 2: 26,973,639 S35P probably benign Het
B4galt3 A G 1: 171,272,519 probably null Het
Bag5 T C 12: 111,710,090 N433S probably benign Het
Birc7 T A 2: 180,932,979 V218D probably benign Het
Catsperg1 T G 7: 29,195,871 N332T possibly damaging Het
Ccdc191 A C 16: 43,908,613 T179P probably damaging Het
Col4a3 C T 1: 82,715,247 probably benign Het
Crlf1 A G 8: 70,498,667 I65M probably benign Het
Dennd4a T G 9: 64,904,227 D1376E probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dlg4 C T 11: 70,042,280 P504L probably damaging Het
Dopey2 A G 16: 93,763,931 T886A probably damaging Het
Dst T A 1: 34,282,586 V4394E probably damaging Het
Endov T C 11: 119,502,360 M112T possibly damaging Het
Eps8 T C 6: 137,479,096 M796V possibly damaging Het
Fam107b T A 2: 3,770,754 Y7* probably null Het
Farsb C T 1: 78,469,251 probably null Het
Fasn A G 11: 120,812,426 M1591T probably benign Het
Fbn2 C T 18: 58,115,659 A384T probably benign Het
Fnta T C 8: 25,999,536 D349G probably damaging Het
Glis3 G T 19: 28,264,009 H842N probably benign Het
Gm17067 G A 7: 42,708,521 P186S probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Ing3 A G 6: 21,968,909 H130R possibly damaging Het
Inpp4b A T 8: 81,952,259 Q306L probably damaging Het
Kcnq2 T C 2: 181,134,897 K66E probably benign Het
Kif21b C A 1: 136,170,059 N1352K probably damaging Het
Lrig3 A T 10: 125,972,134 N84Y probably damaging Het
Mill2 T A 7: 18,855,959 Y55* probably null Het
Mmachc T C 4: 116,705,900 H86R probably damaging Het
Ncbp1 T C 4: 46,165,259 V524A probably benign Het
Olfr1116 A T 2: 87,269,392 T204S possibly damaging Het
Olfr1189 G A 2: 88,592,553 V250M probably damaging Het
Olfr1453 C A 19: 13,027,640 A230S probably benign Het
Olfr312 G A 11: 58,831,987 V278I probably benign Het
Olfr357 T A 2: 36,997,346 C179S probably damaging Het
Olfr832 T C 9: 18,945,170 I174T possibly damaging Het
Pigu G T 2: 155,278,629 Y404* probably null Het
Plaa A T 4: 94,584,007 probably null Het
Plcg2 A T 8: 117,586,557 I487F probably damaging Het
Plekhh2 T C 17: 84,560,152 I162T probably benign Het
Ptprz1 T A 6: 23,001,001 V1030D probably benign Het
Raver2 C A 4: 101,136,139 S505R probably benign Het
Samd7 A T 3: 30,756,620 Q262L probably benign Het
Scn9a T A 2: 66,547,103 N412Y probably damaging Het
Sytl1 C A 4: 133,259,356 R91M probably damaging Het
Tead3 A T 17: 28,336,270 probably benign Het
Tgm1 A G 14: 55,705,643 M580T probably benign Het
Themis A T 10: 28,781,886 Q150L possibly damaging Het
Tmem213 T C 6: 38,109,531 S41P possibly damaging Het
Tnks1bp1 T C 2: 85,063,800 V695A probably damaging Het
Trim23 A T 13: 104,187,509 T159S probably damaging Het
Trim66 T C 7: 109,483,737 Y166C probably benign Het
Troap A T 15: 99,075,794 T111S possibly damaging Het
Ttn T C 2: 76,890,390 probably null Het
Tub T G 7: 109,025,718 S180A probably damaging Het
Vcan A G 13: 89,703,112 V1243A possibly damaging Het
Zfp608 T C 18: 54,987,870 D215G possibly damaging Het
Zfp638 T A 6: 83,967,363 V1021E probably damaging Het
Zim1 T A 7: 6,677,711 I318F probably damaging Het
Other mutations in Hk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Hk3 APN 13 55014426 critical splice donor site probably null
IGL01314:Hk3 APN 13 55007063 splice site probably benign
IGL02043:Hk3 APN 13 55015095 missense probably damaging 1.00
IGL02197:Hk3 APN 13 55014468 missense probably damaging 1.00
IGL02619:Hk3 APN 13 55014294 missense probably damaging 1.00
R0454:Hk3 UTSW 13 55008705 missense probably damaging 1.00
R0518:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0521:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0709:Hk3 UTSW 13 55014730 missense probably damaging 1.00
R1386:Hk3 UTSW 13 55007030 splice site probably null
R1567:Hk3 UTSW 13 55006605 missense probably damaging 1.00
R1647:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1648:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1663:Hk3 UTSW 13 55006575 missense probably benign 0.00
R1936:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1940:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1966:Hk3 UTSW 13 55014455 missense probably damaging 1.00
R2345:Hk3 UTSW 13 55008993 missense probably damaging 1.00
R4838:Hk3 UTSW 13 55006418 missense probably damaging 1.00
R4852:Hk3 UTSW 13 55012596 missense probably damaging 0.99
R4883:Hk3 UTSW 13 55010922 missense probably benign 0.04
R4888:Hk3 UTSW 13 55006592 missense probably damaging 1.00
R5100:Hk3 UTSW 13 55009030 missense probably damaging 1.00
R5253:Hk3 UTSW 13 55011011 missense probably damaging 1.00
R5328:Hk3 UTSW 13 55013493 missense probably benign 0.00
R5441:Hk3 UTSW 13 55015056 missense probably damaging 1.00
R5493:Hk3 UTSW 13 55011171 missense probably damaging 1.00
R5575:Hk3 UTSW 13 55014770 missense probably damaging 0.99
R5578:Hk3 UTSW 13 55012181 missense probably damaging 1.00
R5686:Hk3 UTSW 13 55006813 missense probably damaging 1.00
R5872:Hk3 UTSW 13 55010804 missense probably damaging 1.00
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6314:Hk3 UTSW 13 55013580 missense probably benign 0.02
R6315:Hk3 UTSW 13 55011157 missense probably benign 0.03
R6797:Hk3 UTSW 13 55010831 splice site probably null
R6827:Hk3 UTSW 13 55011352 missense probably damaging 0.98
R6860:Hk3 UTSW 13 55014465 missense probably damaging 0.98
R7082:Hk3 UTSW 13 55006897 missense probably benign 0.40
R7227:Hk3 UTSW 13 55012240 missense probably benign 0.00
R7564:Hk3 UTSW 13 55011396 missense probably damaging 1.00
R8274:Hk3 UTSW 13 55011417 missense possibly damaging 0.95
X0003:Hk3 UTSW 13 55007136 missense probably benign 0.01
Z1177:Hk3 UTSW 13 55010708 missense probably damaging 1.00
Z1177:Hk3 UTSW 13 55010710 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACATGTCTCCAGGCATCCC -3'
(R):5'- GGGGAGCTATTAGGTTCTGCAC -3'

Sequencing Primer
(F):5'- TGTCTCCAGGCATCCCACAAC -3'
(R):5'- GGTTCTGCACCACCCATGTG -3'
Posted On2016-10-24