Incidental Mutation 'R5569:Vash2'
ID 435495
Institutional Source Beutler Lab
Gene Symbol Vash2
Ensembl Gene ENSMUSG00000037568
Gene Name vasohibin 2
Synonyms B130052G07Rik
MMRRC Submission 043126-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R5569 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 190679843-190711493 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 190692488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 229 (V229A)
Ref Sequence ENSEMBL: ENSMUSP00000127626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047409] [ENSMUST00000166139]
AlphaFold Q8C5G2
Predicted Effect possibly damaging
Transcript: ENSMUST00000047409
AA Change: V229A

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036768
Gene: ENSMUSG00000037568
AA Change: V229A

DomainStartEndE-ValueType
Pfam:Vasohibin 45 291 7e-124 PFAM
low complexity region 312 329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166139
AA Change: V229A

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127626
Gene: ENSMUSG00000037568
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
Pfam:Vasohibin 47 291 1.1e-124 PFAM
low complexity region 312 329 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have defects in initiating angiogenesis in response to skin wounding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,764,143 (GRCm39) S929P probably damaging Het
Ackr3 A G 1: 90,142,563 (GRCm39) T341A probably benign Het
Acox3 A G 5: 35,760,377 (GRCm39) Y431C probably damaging Het
Adamtsl2 G A 2: 26,992,845 (GRCm39) V653M probably damaging Het
Anks6 T C 4: 47,045,007 (GRCm39) K300E probably damaging Het
Ap5z1 A T 5: 142,460,206 (GRCm39) D495V probably damaging Het
Atm A T 9: 53,427,750 (GRCm39) Y453* probably null Het
Atpaf2 A T 11: 60,307,706 (GRCm39) W11R probably damaging Het
Bhmt1b A C 18: 87,775,392 (GRCm39) Y305S probably damaging Het
Capn1 T A 19: 6,063,690 (GRCm39) T129S probably benign Het
Catspere2 A T 1: 177,939,162 (GRCm39) K678N possibly damaging Het
Cdh17 A G 4: 11,816,990 (GRCm39) I800M probably damaging Het
Cfap206 C T 4: 34,724,892 (GRCm39) R69Q probably damaging Het
Cp T C 3: 20,033,041 (GRCm39) Y623H probably damaging Het
Dcaf5 A T 12: 80,386,975 (GRCm39) Y384N probably damaging Het
Dhx9 A T 1: 153,342,838 (GRCm39) C555S possibly damaging Het
Dlg2 A G 7: 91,617,388 (GRCm39) T317A probably benign Het
Dsp C T 13: 38,376,628 (GRCm39) T1471I probably benign Het
Ebf1 A G 11: 44,883,228 (GRCm39) M489V possibly damaging Het
Enpp3 T C 10: 24,654,719 (GRCm39) D230G probably damaging Het
Eri3 T C 4: 117,506,553 (GRCm39) M294T possibly damaging Het
Fat1 T A 8: 45,492,873 (GRCm39) V3842E probably damaging Het
Fermt1 T A 2: 132,757,123 (GRCm39) Y569F possibly damaging Het
Fscn1 A G 5: 142,946,799 (GRCm39) D199G probably benign Het
Glce A G 9: 61,977,485 (GRCm39) V133A probably benign Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Hk1 A G 10: 62,122,220 (GRCm39) S520P probably benign Het
Ighv12-3 A G 12: 114,330,555 (GRCm39) V7A probably benign Het
Ighv6-7 C A 12: 114,419,476 (GRCm39) A43S probably damaging Het
Inf2 A G 12: 112,568,113 (GRCm39) I222V possibly damaging Het
Kmo T A 1: 175,482,688 (GRCm39) N337K probably benign Het
Mcf2l C T 8: 13,055,481 (GRCm39) R611W probably damaging Het
Mipep A T 14: 61,040,383 (GRCm39) H301L probably damaging Het
Mprip A T 11: 59,651,789 (GRCm39) E1831V probably damaging Het
Mrgpra3 T C 7: 47,239,759 (GRCm39) T56A probably benign Het
Mtmr14 G A 6: 113,217,246 (GRCm39) V53I probably damaging Het
Mycbp2 A T 14: 103,372,679 (GRCm39) W4056R probably damaging Het
Myl2 A T 5: 122,244,783 (GRCm39) D151V possibly damaging Het
Myo5c A T 9: 75,180,792 (GRCm39) D727V probably damaging Het
Or10s1 A G 9: 39,985,593 (GRCm39) M1V probably null Het
Or1e22 A T 11: 73,377,518 (GRCm39) I44N probably damaging Het
Or2ag12 A T 7: 106,277,690 (GRCm39) M1K probably null Het
Or56b1b T A 7: 108,164,772 (GRCm39) M77L probably benign Het
Or9s18 A G 13: 65,300,793 (GRCm39) T252A possibly damaging Het
Pabpc1l C T 2: 163,885,474 (GRCm39) T409I probably benign Het
Pcgf1 C T 6: 83,056,686 (GRCm39) R81* probably null Het
Pcgf2 A G 11: 97,583,193 (GRCm39) probably null Het
Phf14 T A 6: 11,934,015 (GRCm39) N292K probably damaging Het
Plin4 T C 17: 56,409,147 (GRCm39) T1358A probably benign Het
Pomgnt1 T C 4: 116,013,164 (GRCm39) S423P probably damaging Het
Prep G A 10: 44,973,533 (GRCm39) V214I probably benign Het
Ptger1 T C 8: 84,394,961 (GRCm39) probably null Het
Pus7 C T 5: 23,953,832 (GRCm39) G415D probably benign Het
Rbm44 C T 1: 91,096,460 (GRCm39) P940S probably damaging Het
Ripor1 A T 8: 106,344,147 (GRCm39) D427V probably damaging Het
Rp1 A G 1: 4,415,460 (GRCm39) I1884T probably damaging Het
Rpl15-ps6 T C 15: 52,341,624 (GRCm39) noncoding transcript Het
Serinc2 T C 4: 130,172,272 (GRCm39) R7G probably benign Het
Serpina6 A C 12: 103,620,719 (GRCm39) F10C possibly damaging Het
Skint5 T A 4: 113,545,903 (GRCm39) probably null Het
Slc66a3 T A 12: 17,045,629 (GRCm39) I114F possibly damaging Het
Slc6a4 A T 11: 76,914,081 (GRCm39) I544F possibly damaging Het
Spdye4b T C 5: 143,188,176 (GRCm39) M223T probably benign Het
Tbc1d17 A T 7: 44,497,755 (GRCm39) V39D probably damaging Het
Thbs3 T A 3: 89,126,770 (GRCm39) Y295N probably damaging Het
Themis G A 10: 28,657,887 (GRCm39) E152K possibly damaging Het
Tmem131 A T 1: 36,838,419 (GRCm39) I1502N probably benign Het
Tmem43 T A 6: 91,454,336 (GRCm39) M41K probably benign Het
Tmprss6 A C 15: 78,324,503 (GRCm39) W771G probably damaging Het
Trp53tg5 T C 2: 164,313,256 (GRCm39) T140A probably benign Het
Uchl1 A G 5: 66,844,216 (GRCm39) E206G probably damaging Het
Vmn1r192 C A 13: 22,371,384 (GRCm39) A279S possibly damaging Het
Vmn1r32 T C 6: 66,530,156 (GRCm39) R207G probably damaging Het
Vmn2r14 T A 5: 109,368,261 (GRCm39) M244L probably benign Het
Vwa5b2 T A 16: 20,414,089 (GRCm39) H236Q probably damaging Het
Zfp652 C T 11: 95,640,116 (GRCm39) P14S probably benign Het
Zfp668 G A 7: 127,466,995 (GRCm39) R194* probably null Het
Zgrf1 G T 3: 127,354,674 (GRCm39) V98L probably benign Het
Other mutations in Vash2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02345:Vash2 APN 1 190,710,412 (GRCm39) missense probably benign 0.15
Logical UTSW 1 190,692,422 (GRCm39) missense probably benign 0.11
R0507:Vash2 UTSW 1 190,699,115 (GRCm39) splice site probably benign
R2265:Vash2 UTSW 1 190,682,410 (GRCm39) missense probably damaging 0.97
R3615:Vash2 UTSW 1 190,702,616 (GRCm39) missense probably damaging 1.00
R3616:Vash2 UTSW 1 190,702,616 (GRCm39) missense probably damaging 1.00
R4610:Vash2 UTSW 1 190,692,498 (GRCm39) missense probably benign 0.04
R4844:Vash2 UTSW 1 190,710,691 (GRCm39) utr 5 prime probably benign
R6282:Vash2 UTSW 1 190,692,422 (GRCm39) missense probably benign 0.11
R6312:Vash2 UTSW 1 190,690,880 (GRCm39) missense probably benign 0.29
R6468:Vash2 UTSW 1 190,710,484 (GRCm39) missense probably damaging 1.00
R7362:Vash2 UTSW 1 190,692,496 (GRCm39) missense probably damaging 1.00
X0021:Vash2 UTSW 1 190,692,641 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAAGGAAGCTCCCACAC -3'
(R):5'- CTATCTCACCAATGGGCAGC -3'

Sequencing Primer
(F):5'- GAGCTCACCTTCATCCGCATG -3'
(R):5'- ATGGGCAGCCTTCCATTGAG -3'
Posted On 2016-10-24