Mutagenetix > Incidental Mutation

Incidental Mutation 'R5569:Adamtsl2'

435496

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

043126-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5569 (G1)

Quality Score

114

Status

Not validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 27102833 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 653 (V653M)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

probably damaging
Transcript: ENSMUST00000091233
AA Change: V653M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: V653M

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130600

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169787

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	A	G	5: 121,626,080	S929P	probably damaging	Het
Ackr3	A	G	1: 90,214,841	T341A	probably benign	Het
Acox3	A	G	5: 35,603,033	Y431C	probably damaging	Het
Anks6	T	C	4: 47,045,007	K300E	probably damaging	Het
Ap5z1	A	T	5: 142,474,451	D495V	probably damaging	Het
Atm	A	T	9: 53,516,450	Y453*	probably null	Het
Atpaf2	A	T	11: 60,416,880	W11R	probably damaging	Het
Capn1	T	A	19: 6,013,660	T129S	probably benign	Het
Cdh17	A	G	4: 11,816,990	I800M	probably damaging	Het
Cfap206	C	T	4: 34,724,892	R69Q	probably damaging	Het
Cp	T	C	3: 19,978,877	Y623H	probably damaging	Het
Dcaf5	A	T	12: 80,340,201	Y384N	probably damaging	Het
Dhx9	A	T	1: 153,467,092	C555S	possibly damaging	Het
Dlg2	A	G	7: 91,968,180	T317A	probably benign	Het
Dsp	C	T	13: 38,192,652	T1471I	probably benign	Het
Ebf1	A	G	11: 44,992,401	M489V	possibly damaging	Het
Enpp3	T	C	10: 24,778,821	D230G	probably damaging	Het
Eri3	T	C	4: 117,649,356	M294T	possibly damaging	Het
Fat1	T	A	8: 45,039,836	V3842E	probably damaging	Het
Fermt1	T	A	2: 132,915,203	Y569F	possibly damaging	Het
Fscn1	A	G	5: 142,961,044	D199G	probably benign	Het
Glce	A	G	9: 62,070,203	V133A	probably benign	Het
Gm10020	T	C	15: 52,478,228		noncoding transcript	Het
Gm16432	A	T	1: 178,111,596	K678N	possibly damaging	Het
Gm5096	A	C	18: 87,757,268	Y305S	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Hk1	A	G	10: 62,286,441	S520P	probably benign	Het
Ighv12-3	A	G	12: 114,366,935	V7A	probably benign	Het
Ighv6-7	C	A	12: 114,455,856	A43S	probably damaging	Het
Inf2	A	G	12: 112,601,679	I222V	possibly damaging	Het
Kmo	T	A	1: 175,655,122	N337K	probably benign	Het
Mcf2l	C	T	8: 13,005,481	R611W	probably damaging	Het
Mipep	A	T	14: 60,802,934	H301L	probably damaging	Het
Mprip	A	T	11: 59,760,963	E1831V	probably damaging	Het
Mrgpra3	T	C	7: 47,590,011	T56A	probably benign	Het
Mtmr14	G	A	6: 113,240,285	V53I	probably damaging	Het
Mycbp2	A	T	14: 103,135,243	W4056R	probably damaging	Het
Myl2	A	T	5: 122,106,720	D151V	possibly damaging	Het
Myo5c	A	T	9: 75,273,510	D727V	probably damaging	Het
Olfr381	A	T	11: 73,486,692	I44N	probably damaging	Het
Olfr466	A	G	13: 65,152,979	T252A	possibly damaging	Het
Olfr504	T	A	7: 108,565,565	M77L	probably benign	Het
Olfr693	A	T	7: 106,678,483	M1K	probably null	Het
Olfr982	A	G	9: 40,074,297	M1V	probably null	Het
Pabpc1l	C	T	2: 164,043,554	T409I	probably benign	Het
Pcgf1	C	T	6: 83,079,705	R81*	probably null	Het
Pcgf2	A	G	11: 97,692,367		probably null	Het
Phf14	T	A	6: 11,934,016	N292K	probably damaging	Het
Plin4	T	C	17: 56,102,147	T1358A	probably benign	Het
Pomgnt1	T	C	4: 116,155,967	S423P	probably damaging	Het
Pqlc3	T	A	12: 16,995,628	I114F	possibly damaging	Het
Prep	G	A	10: 45,097,437	V214I	probably benign	Het
Ptger1	T	C	8: 83,668,332		probably null	Het
Pus7	C	T	5: 23,748,834	G415D	probably benign	Het
Rbm44	C	T	1: 91,168,738	P940S	probably damaging	Het
Ripor1	A	T	8: 105,617,515	D427V	probably damaging	Het
Rp1	A	G	1: 4,345,237	I1884T	probably damaging	Het
Serinc2	T	C	4: 130,278,479	R7G	probably benign	Het
Serpina6	A	C	12: 103,654,460	F10C	possibly damaging	Het
Skint5	T	A	4: 113,688,706		probably null	Het
Slc6a4	A	T	11: 77,023,255	I544F	possibly damaging	Het
Spdye4b	T	C	5: 143,202,421	M223T	probably benign	Het
Tbc1d17	A	T	7: 44,848,331	V39D	probably damaging	Het
Thbs3	T	A	3: 89,219,463	Y295N	probably damaging	Het
Themis	G	A	10: 28,781,891	E152K	possibly damaging	Het
Tmem131	A	T	1: 36,799,338	I1502N	probably benign	Het
Tmem43	T	A	6: 91,477,354	M41K	probably benign	Het
Tmprss6	A	C	15: 78,440,303	W771G	probably damaging	Het
Trp53tg5	T	C	2: 164,471,336	T140A	probably benign	Het
Uchl1	A	G	5: 66,686,873	E206G	probably damaging	Het
Vash2	A	G	1: 190,960,291	V229A	possibly damaging	Het
Vmn1r192	C	A	13: 22,187,214	A279S	possibly damaging	Het
Vmn1r32	T	C	6: 66,553,172	R207G	probably damaging	Het
Vmn2r14	T	A	5: 109,220,395	M244L	probably benign	Het
Vwa5b2	T	A	16: 20,595,339	H236Q	probably damaging	Het
Zfp652	C	T	11: 95,749,290	P14S	probably benign	Het
Zfp668	G	A	7: 127,867,823	R194*	probably null	Het
Zgrf1	G	T	3: 127,561,025	V98L	probably benign	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
R9284:Adamtsl2	UTSW	2	27104043	splice site	probably benign
R9566:Adamtsl2	UTSW	2	27089761	critical splice donor site	probably null
R9772:Adamtsl2	UTSW	2	27095654	missense	probably benign
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TAACATGGGCACAGTCCAC -3'
(R):5'- GTGCACTACGAGGAAGTCAG -3'

Sequencing Primer
(F):5'- CACACTGGCAGGTCTCATC -3'
(R):5'- TGGCACATCTGTTCTCAGG -3'

Posted On

2016-10-24