Incidental Mutation 'R5569:Adamtsl2'
ID435496
Institutional Source Beutler Lab
Gene Symbol Adamtsl2
Ensembl Gene ENSMUSG00000036040
Gene NameADAMTS-like 2
SynonymsA930008K15Rik
MMRRC Submission 043126-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5569 (G1)
Quality Score114
Status Not validated
Chromosome2
Chromosomal Location27079379-27108981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27102833 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 653 (V653M)
Ref Sequence ENSEMBL: ENSMUSP00000088774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091233]
Predicted Effect probably damaging
Transcript: ENSMUST00000091233
AA Change: V653M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: V653M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSP1 50 106 5.14e-7 SMART
Pfam:ADAM_spacer1 214 331 5.4e-28 PFAM
low complexity region 345 358 N/A INTRINSIC
TSP1 573 629 8.15e-1 SMART
TSP1 631 692 1.85e-2 SMART
TSP1 694 744 4.15e-1 SMART
TSP1 747 796 9.98e-5 SMART
TSP1 803 861 4.95e-2 SMART
TSP1 863 914 2.53e-6 SMART
Pfam:PLAC 922 953 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169787
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Ackr3 A G 1: 90,214,841 T341A probably benign Het
Acox3 A G 5: 35,603,033 Y431C probably damaging Het
Anks6 T C 4: 47,045,007 K300E probably damaging Het
Ap5z1 A T 5: 142,474,451 D495V probably damaging Het
Atm A T 9: 53,516,450 Y453* probably null Het
Atpaf2 A T 11: 60,416,880 W11R probably damaging Het
Capn1 T A 19: 6,013,660 T129S probably benign Het
Cdh17 A G 4: 11,816,990 I800M probably damaging Het
Cfap206 C T 4: 34,724,892 R69Q probably damaging Het
Cp T C 3: 19,978,877 Y623H probably damaging Het
Dcaf5 A T 12: 80,340,201 Y384N probably damaging Het
Dhx9 A T 1: 153,467,092 C555S possibly damaging Het
Dlg2 A G 7: 91,968,180 T317A probably benign Het
Dsp C T 13: 38,192,652 T1471I probably benign Het
Ebf1 A G 11: 44,992,401 M489V possibly damaging Het
Enpp3 T C 10: 24,778,821 D230G probably damaging Het
Eri3 T C 4: 117,649,356 M294T possibly damaging Het
Fat1 T A 8: 45,039,836 V3842E probably damaging Het
Fermt1 T A 2: 132,915,203 Y569F possibly damaging Het
Fscn1 A G 5: 142,961,044 D199G probably benign Het
Glce A G 9: 62,070,203 V133A probably benign Het
Gm10020 T C 15: 52,478,228 noncoding transcript Het
Gm16432 A T 1: 178,111,596 K678N possibly damaging Het
Gm5096 A C 18: 87,757,268 Y305S probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hk1 A G 10: 62,286,441 S520P probably benign Het
Ighv12-3 A G 12: 114,366,935 V7A probably benign Het
Ighv6-7 C A 12: 114,455,856 A43S probably damaging Het
Inf2 A G 12: 112,601,679 I222V possibly damaging Het
Kmo T A 1: 175,655,122 N337K probably benign Het
Mcf2l C T 8: 13,005,481 R611W probably damaging Het
Mipep A T 14: 60,802,934 H301L probably damaging Het
Mprip A T 11: 59,760,963 E1831V probably damaging Het
Mrgpra3 T C 7: 47,590,011 T56A probably benign Het
Mtmr14 G A 6: 113,240,285 V53I probably damaging Het
Mycbp2 A T 14: 103,135,243 W4056R probably damaging Het
Myl2 A T 5: 122,106,720 D151V possibly damaging Het
Myo5c A T 9: 75,273,510 D727V probably damaging Het
Olfr381 A T 11: 73,486,692 I44N probably damaging Het
Olfr466 A G 13: 65,152,979 T252A possibly damaging Het
Olfr504 T A 7: 108,565,565 M77L probably benign Het
Olfr693 A T 7: 106,678,483 M1K probably null Het
Olfr982 A G 9: 40,074,297 M1V probably null Het
Pabpc1l C T 2: 164,043,554 T409I probably benign Het
Pcgf1 C T 6: 83,079,705 R81* probably null Het
Pcgf2 A G 11: 97,692,367 probably null Het
Phf14 T A 6: 11,934,016 N292K probably damaging Het
Plin4 T C 17: 56,102,147 T1358A probably benign Het
Pomgnt1 T C 4: 116,155,967 S423P probably damaging Het
Pqlc3 T A 12: 16,995,628 I114F possibly damaging Het
Prep G A 10: 45,097,437 V214I probably benign Het
Ptger1 T C 8: 83,668,332 probably null Het
Pus7 C T 5: 23,748,834 G415D probably benign Het
Rbm44 C T 1: 91,168,738 P940S probably damaging Het
Ripor1 A T 8: 105,617,515 D427V probably damaging Het
Rp1 A G 1: 4,345,237 I1884T probably damaging Het
Serinc2 T C 4: 130,278,479 R7G probably benign Het
Serpina6 A C 12: 103,654,460 F10C possibly damaging Het
Skint5 T A 4: 113,688,706 probably null Het
Slc6a4 A T 11: 77,023,255 I544F possibly damaging Het
Spdye4b T C 5: 143,202,421 M223T probably benign Het
Tbc1d17 A T 7: 44,848,331 V39D probably damaging Het
Thbs3 T A 3: 89,219,463 Y295N probably damaging Het
Themis G A 10: 28,781,891 E152K possibly damaging Het
Tmem131 A T 1: 36,799,338 I1502N probably benign Het
Tmem43 T A 6: 91,477,354 M41K probably benign Het
Tmprss6 A C 15: 78,440,303 W771G probably damaging Het
Trp53tg5 T C 2: 164,471,336 T140A probably benign Het
Uchl1 A G 5: 66,686,873 E206G probably damaging Het
Vash2 A G 1: 190,960,291 V229A possibly damaging Het
Vmn1r192 C A 13: 22,187,214 A279S possibly damaging Het
Vmn1r32 T C 6: 66,553,172 R207G probably damaging Het
Vmn2r14 T A 5: 109,220,395 M244L probably benign Het
Vwa5b2 T A 16: 20,595,339 H236Q probably damaging Het
Zfp652 C T 11: 95,749,290 P14S probably benign Het
Zfp668 G A 7: 127,867,823 R194* probably null Het
Zgrf1 G T 3: 127,561,025 V98L probably benign Het
Other mutations in Adamtsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Adamtsl2 APN 2 27085088 missense probably damaging 1.00
IGL01902:Adamtsl2 APN 2 27087252 missense probably damaging 1.00
IGL02207:Adamtsl2 APN 2 27102981 missense probably damaging 0.99
IGL02247:Adamtsl2 APN 2 27084893 missense probably damaging 1.00
IGL02253:Adamtsl2 APN 2 27098697 missense possibly damaging 0.48
IGL02655:Adamtsl2 APN 2 27082530 splice site probably benign
IGL03148:Adamtsl2 APN 2 27084059 missense probably damaging 0.99
IGL03269:Adamtsl2 APN 2 27108355 nonsense probably null
R0609:Adamtsl2 UTSW 2 27089635 missense probably benign 0.25
R1183:Adamtsl2 UTSW 2 27084080 missense probably damaging 1.00
R1443:Adamtsl2 UTSW 2 27103066 missense possibly damaging 0.89
R1675:Adamtsl2 UTSW 2 27082485 frame shift probably null
R1698:Adamtsl2 UTSW 2 27103127 missense possibly damaging 0.92
R1765:Adamtsl2 UTSW 2 27102830 missense probably benign 0.01
R1934:Adamtsl2 UTSW 2 27089593 missense probably damaging 0.99
R2106:Adamtsl2 UTSW 2 27102825 missense probably benign 0.02
R2108:Adamtsl2 UTSW 2 27095558 missense probably benign
R2189:Adamtsl2 UTSW 2 27081738 missense probably benign 0.00
R2232:Adamtsl2 UTSW 2 27103178 missense probably damaging 1.00
R4301:Adamtsl2 UTSW 2 27087283 missense probably null 1.00
R4518:Adamtsl2 UTSW 2 27095547 missense probably benign 0.00
R4572:Adamtsl2 UTSW 2 27083256 missense probably damaging 0.99
R4627:Adamtsl2 UTSW 2 27093585 missense probably damaging 0.99
R4668:Adamtsl2 UTSW 2 27095475 missense probably benign 0.00
R4686:Adamtsl2 UTSW 2 27093825 missense probably damaging 0.99
R4821:Adamtsl2 UTSW 2 27098592 splice site probably null
R5054:Adamtsl2 UTSW 2 27101720 missense probably damaging 1.00
R5460:Adamtsl2 UTSW 2 27095398 splice site probably null
R5694:Adamtsl2 UTSW 2 27081724 missense probably benign 0.03
R6836:Adamtsl2 UTSW 2 27081706 start codon destroyed probably null 0.90
R7103:Adamtsl2 UTSW 2 27107461 missense probably damaging 1.00
R7437:Adamtsl2 UTSW 2 27089709 missense probably damaging 0.99
X0003:Adamtsl2 UTSW 2 27081772 small deletion probably benign
X0003:Adamtsl2 UTSW 2 27081773 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TAACATGGGCACAGTCCAC -3'
(R):5'- GTGCACTACGAGGAAGTCAG -3'

Sequencing Primer
(F):5'- CACACTGGCAGGTCTCATC -3'
(R):5'- TGGCACATCTGTTCTCAGG -3'
Posted On2016-10-24