Mutagenetix > Incidental Mutations

Incidental Mutation 'R5569:Cdh17'

435506

Institutional Source

Beutler Lab

Gene Symbol

Cdh17

Ensembl Gene

ENSMUSG00000028217

Gene Name

cadherin 17

Synonyms

BILL-cadherin, LI-cadherin, HPT-1

MMRRC Submission

043126-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R5569 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11758147-11817895 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11816990 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 800 (I800M)

Ref Sequence

ENSEMBL: ENSMUSP00000029871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029871]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029871
AA Change: I800M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029871
Gene: ENSMUSG00000028217
AA Change: I800M

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	44	123	5.27e-10	SMART
CA	147	241	6.9e-14	SMART
CA	258	337	3.05e-15	SMART
CA	361	446	3.29e-11	SMART
CA	471	564	5.27e-10	SMART
CA	587	664	5.59e-23	SMART
Blast:CA	687	771	5e-39	BLAST
transmembrane domain	784	806	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit impaired B lymphocyte development and impaired IgG1 and IgG3 antibody response to T-independent antigen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	A	G	5: 121,626,080	S929P	probably damaging	Het
Ackr3	A	G	1: 90,214,841	T341A	probably benign	Het
Acox3	A	G	5: 35,603,033	Y431C	probably damaging	Het
Adamtsl2	G	A	2: 27,102,833	V653M	probably damaging	Het
Anks6	T	C	4: 47,045,007	K300E	probably damaging	Het
Ap5z1	A	T	5: 142,474,451	D495V	probably damaging	Het
Atm	A	T	9: 53,516,450	Y453*	probably null	Het
Atpaf2	A	T	11: 60,416,880	W11R	probably damaging	Het
Capn1	T	A	19: 6,013,660	T129S	probably benign	Het
Cfap206	C	T	4: 34,724,892	R69Q	probably damaging	Het
Cp	T	C	3: 19,978,877	Y623H	probably damaging	Het
Dcaf5	A	T	12: 80,340,201	Y384N	probably damaging	Het
Dhx9	A	T	1: 153,467,092	C555S	possibly damaging	Het
Dlg2	A	G	7: 91,968,180	T317A	probably benign	Het
Dsp	C	T	13: 38,192,652	T1471I	probably benign	Het
Ebf1	A	G	11: 44,992,401	M489V	possibly damaging	Het
Enpp3	T	C	10: 24,778,821	D230G	probably damaging	Het
Eri3	T	C	4: 117,649,356	M294T	possibly damaging	Het
Fat1	T	A	8: 45,039,836	V3842E	probably damaging	Het
Fermt1	T	A	2: 132,915,203	Y569F	possibly damaging	Het
Fscn1	A	G	5: 142,961,044	D199G	probably benign	Het
Glce	A	G	9: 62,070,203	V133A	probably benign	Het
Gm10020	T	C	15: 52,478,228		noncoding transcript	Het
Gm16432	A	T	1: 178,111,596	K678N	possibly damaging	Het
Gm5096	A	C	18: 87,757,268	Y305S	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Hk1	A	G	10: 62,286,441	S520P	probably benign	Het
Ighv12-3	A	G	12: 114,366,935	V7A	probably benign	Het
Ighv6-7	C	A	12: 114,455,856	A43S	probably damaging	Het
Inf2	A	G	12: 112,601,679	I222V	possibly damaging	Het
Kmo	T	A	1: 175,655,122	N337K	probably benign	Het
Mcf2l	C	T	8: 13,005,481	R611W	probably damaging	Het
Mipep	A	T	14: 60,802,934	H301L	probably damaging	Het
Mprip	A	T	11: 59,760,963	E1831V	probably damaging	Het
Mrgpra3	T	C	7: 47,590,011	T56A	probably benign	Het
Mtmr14	G	A	6: 113,240,285	V53I	probably damaging	Het
Mycbp2	A	T	14: 103,135,243	W4056R	probably damaging	Het
Myl2	A	T	5: 122,106,720	D151V	possibly damaging	Het
Myo5c	A	T	9: 75,273,510	D727V	probably damaging	Het
Olfr381	A	T	11: 73,486,692	I44N	probably damaging	Het
Olfr466	A	G	13: 65,152,979	T252A	possibly damaging	Het
Olfr504	T	A	7: 108,565,565	M77L	probably benign	Het
Olfr693	A	T	7: 106,678,483	M1K	probably null	Het
Olfr982	A	G	9: 40,074,297	M1V	probably null	Het
Pabpc1l	C	T	2: 164,043,554	T409I	probably benign	Het
Pcgf1	C	T	6: 83,079,705	R81*	probably null	Het
Pcgf2	A	G	11: 97,692,367		probably null	Het
Phf14	T	A	6: 11,934,016	N292K	probably damaging	Het
Plin4	T	C	17: 56,102,147	T1358A	probably benign	Het
Pomgnt1	T	C	4: 116,155,967	S423P	probably damaging	Het
Pqlc3	T	A	12: 16,995,628	I114F	possibly damaging	Het
Prep	G	A	10: 45,097,437	V214I	probably benign	Het
Ptger1	T	C	8: 83,668,332		probably null	Het
Pus7	C	T	5: 23,748,834	G415D	probably benign	Het
Rbm44	C	T	1: 91,168,738	P940S	probably damaging	Het
Ripor1	A	T	8: 105,617,515	D427V	probably damaging	Het
Rp1	A	G	1: 4,345,237	I1884T	probably damaging	Het
Serinc2	T	C	4: 130,278,479	R7G	probably benign	Het
Serpina6	A	C	12: 103,654,460	F10C	possibly damaging	Het
Skint5	T	A	4: 113,688,706		probably null	Het
Slc6a4	A	T	11: 77,023,255	I544F	possibly damaging	Het
Spdye4b	T	C	5: 143,202,421	M223T	probably benign	Het
Tbc1d17	A	T	7: 44,848,331	V39D	probably damaging	Het
Thbs3	T	A	3: 89,219,463	Y295N	probably damaging	Het
Themis	G	A	10: 28,781,891	E152K	possibly damaging	Het
Tmem131	A	T	1: 36,799,338	I1502N	probably benign	Het
Tmem43	T	A	6: 91,477,354	M41K	probably benign	Het
Tmprss6	A	C	15: 78,440,303	W771G	probably damaging	Het
Trp53tg5	T	C	2: 164,471,336	T140A	probably benign	Het
Uchl1	A	G	5: 66,686,873	E206G	probably damaging	Het
Vash2	A	G	1: 190,960,291	V229A	possibly damaging	Het
Vmn1r192	C	A	13: 22,187,214	A279S	possibly damaging	Het
Vmn1r32	T	C	6: 66,553,172	R207G	probably damaging	Het
Vmn2r14	T	A	5: 109,220,395	M244L	probably benign	Het
Vwa5b2	T	A	16: 20,595,339	H236Q	probably damaging	Het
Zfp652	C	T	11: 95,749,290	P14S	probably benign	Het
Zfp668	G	A	7: 127,867,823	R194*	probably null	Het
Zgrf1	G	T	3: 127,561,025	V98L	probably benign	Het

Other mutations in Cdh17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Cdh17	APN	4	11797780	splice site	probably benign
IGL00823:Cdh17	APN	4	11783412	missense	possibly damaging	0.78
IGL00824:Cdh17	APN	4	11784675	missense	probably benign	0.00
IGL01572:Cdh17	APN	4	11784621	splice site	probably benign
IGL01602:Cdh17	APN	4	11795670	missense	probably damaging	1.00
IGL01605:Cdh17	APN	4	11795670	missense	probably damaging	1.00
IGL01759:Cdh17	APN	4	11771262	splice site	probably benign
IGL02065:Cdh17	APN	4	11771373	splice site	probably benign
IGL02448:Cdh17	APN	4	11784680	missense	probably benign
IGL02869:Cdh17	APN	4	11814908	missense	probably benign	0.00
IGL03088:Cdh17	APN	4	11810473	missense	probably damaging	1.00
Disruptive	UTSW	4	11784654	missense	probably damaging	1.00
R0054:Cdh17	UTSW	4	11785186	missense	possibly damaging	0.59
R0081:Cdh17	UTSW	4	11785280	splice site	probably benign
R0101:Cdh17	UTSW	4	11771341	missense	probably benign	0.00
R0432:Cdh17	UTSW	4	11771273	nonsense	probably null
R0718:Cdh17	UTSW	4	11810451	missense	possibly damaging	0.68
R0946:Cdh17	UTSW	4	11795581	missense	probably benign	0.01
R1076:Cdh17	UTSW	4	11795581	missense	probably benign	0.01
R1217:Cdh17	UTSW	4	11799676	missense	probably benign	0.04
R2060:Cdh17	UTSW	4	11803982	missense	probably benign	0.03
R3808:Cdh17	UTSW	4	11795671	missense	probably damaging	0.99
R3850:Cdh17	UTSW	4	11785201	missense	probably damaging	1.00
R4111:Cdh17	UTSW	4	11814628	missense	probably damaging	0.99
R4112:Cdh17	UTSW	4	11814628	missense	probably damaging	0.99
R4583:Cdh17	UTSW	4	11810466	missense	probably benign	0.00
R4683:Cdh17	UTSW	4	11817036	missense	possibly damaging	0.78
R4797:Cdh17	UTSW	4	11810390	missense	probably benign	0.00
R5050:Cdh17	UTSW	4	11784654	missense	probably damaging	1.00
R5071:Cdh17	UTSW	4	11810325	missense	probably damaging	0.98
R5790:Cdh17	UTSW	4	11814945	splice site	probably null
R6077:Cdh17	UTSW	4	11803969	missense	probably benign	0.22
R6581:Cdh17	UTSW	4	11799615	missense	probably damaging	1.00
R7274:Cdh17	UTSW	4	11783174	nonsense	probably null
R7647:Cdh17	UTSW	4	11814698	missense	probably damaging	1.00
R7649:Cdh17	UTSW	4	11814698	missense	probably damaging	1.00
R7934:Cdh17	UTSW	4	11799754	critical splice donor site	probably null
R8290:Cdh17	UTSW	4	11817037	missense	probably benign
R8301:Cdh17	UTSW	4	11795659	missense	probably damaging	0.99
X0067:Cdh17	UTSW	4	11785224	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTATCCAAGAGAGCCAATGCC -3'
(R):5'- ATTATGAGATTAAACAGCTGGGGAC -3'

Sequencing Primer
(F):5'- TGCCCAGAGCTCTATACTCACTAG -3'
(R):5'- GGACCAGATATAGCCCATGATGC -3'

Posted On

2016-10-24