Mutagenetix > Incidental Mutation

Incidental Mutation 'R5569:Mcf2l'

435536

Institutional Source

Beutler Lab

Gene Symbol

Mcf2l

Ensembl Gene

ENSMUSG00000031442

Gene Name

mcf.2 transforming sequence-like

Synonyms

C130040G20Rik, Dbs

MMRRC Submission

043126-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5569 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12873806-13020905 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 13005481 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 611 (R611W)

Ref Sequence

ENSEMBL: ENSMUSP00000133776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110866] [ENSMUST00000110867] [ENSMUST00000110871] [ENSMUST00000110873] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000145067] [ENSMUST00000173006] [ENSMUST00000173099]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000095456
AA Change: R645W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442
AA Change: R645W

Domain	Start	End	E-Value	Type
SEC14	75	221	1.77e-24	SMART
SPEC	354	455	4.41e-15	SMART
coiled coil region	507	529	N/A	INTRINSIC
low complexity region	578	594	N/A	INTRINSIC
RhoGEF	636	811	2.83e-63	SMART
PH	831	948	8.13e-14	SMART
low complexity region	966	978	N/A	INTRINSIC
SH3	1058	1115	3.33e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098927
AA Change: R619W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442
AA Change: R619W

Domain	Start	End	E-Value	Type
SEC14	49	195	1.77e-24	SMART
SPEC	328	429	4.41e-15	SMART
coiled coil region	481	503	N/A	INTRINSIC
low complexity region	552	568	N/A	INTRINSIC
RhoGEF	610	785	2.83e-63	SMART
PH	805	922	8.13e-14	SMART
low complexity region	940	952	N/A	INTRINSIC
low complexity region	1022	1033	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110866
AA Change: R593W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106490
Gene: ENSMUSG00000031442
AA Change: R593W

Domain	Start	End	E-Value	Type
SEC14	23	169	1.77e-24	SMART
SPEC	302	403	4.41e-15	SMART
coiled coil region	455	477	N/A	INTRINSIC
low complexity region	526	542	N/A	INTRINSIC
RhoGEF	584	759	2.83e-63	SMART
PH	779	896	8.13e-14	SMART
low complexity region	914	926	N/A	INTRINSIC
SH3	1006	1063	3.33e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110867
AA Change: R593W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106491
Gene: ENSMUSG00000031442
AA Change: R593W

Domain	Start	End	E-Value	Type
SEC14	23	169	1.77e-24	SMART
SPEC	302	403	4.41e-15	SMART
coiled coil region	455	477	N/A	INTRINSIC
low complexity region	526	542	N/A	INTRINSIC
RhoGEF	584	759	2.83e-63	SMART
PH	779	896	8.13e-14	SMART
low complexity region	914	926	N/A	INTRINSIC
SH3	1006	1063	3.33e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110871
AA Change: R613W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106495
Gene: ENSMUSG00000031442
AA Change: R613W

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SEC14	43	189	1.77e-24	SMART
SPEC	322	423	4.41e-15	SMART
coiled coil region	475	497	N/A	INTRINSIC
low complexity region	546	562	N/A	INTRINSIC
RhoGEF	604	779	2.83e-63	SMART
PH	799	916	8.13e-14	SMART
low complexity region	934	946	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110873
AA Change: R456W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106497
Gene: ENSMUSG00000031442
AA Change: R456W

Domain	Start	End	E-Value	Type
SPEC	165	266	4.41e-15	SMART
coiled coil region	318	340	N/A	INTRINSIC
low complexity region	389	405	N/A	INTRINSIC
RhoGEF	447	622	2.83e-63	SMART
PH	642	759	8.13e-14	SMART
low complexity region	777	789	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110876
AA Change: R615W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442
AA Change: R615W

Domain	Start	End	E-Value	Type
SEC14	45	191	1.77e-24	SMART
SPEC	324	425	4.41e-15	SMART
coiled coil region	477	499	N/A	INTRINSIC
low complexity region	548	564	N/A	INTRINSIC
RhoGEF	606	781	2.83e-63	SMART
PH	801	918	8.13e-14	SMART
low complexity region	936	948	N/A	INTRINSIC
SH3	1084	1141	3.33e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110879
AA Change: R615W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442
AA Change: R615W

Domain	Start	End	E-Value	Type
SEC14	45	191	1.77e-24	SMART
SPEC	324	425	4.41e-15	SMART
coiled coil region	477	499	N/A	INTRINSIC
low complexity region	548	564	N/A	INTRINSIC
RhoGEF	606	781	2.83e-63	SMART
PH	801	918	8.13e-14	SMART
low complexity region	936	948	N/A	INTRINSIC
SH3	1028	1085	3.33e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000126905
AA Change: R277W

SMART Domains

Protein: ENSMUSP00000118540
Gene: ENSMUSG00000031442
AA Change: R277W

Domain	Start	End	E-Value	Type
SPEC	5	88	8.25e-6	SMART
coiled coil region	139	161	N/A	INTRINSIC
low complexity region	211	227	N/A	INTRINSIC
RhoGEF	269	444	2.83e-63	SMART
PH	464	581	8.13e-14	SMART
low complexity region	599	611	N/A	INTRINSIC
SH3	716	773	3.33e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000145067
AA Change: R552W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133577
Gene: ENSMUSG00000031442
AA Change: R552W

Domain	Start	End	E-Value	Type
Pfam:CRAL_TRIO_2	16	132	2.4e-12	PFAM
SPEC	261	362	4.41e-15	SMART
coiled coil region	414	436	N/A	INTRINSIC
low complexity region	485	501	N/A	INTRINSIC
RhoGEF	543	718	2.83e-63	SMART
PH	738	855	8.13e-14	SMART
low complexity region	873	885	N/A	INTRINSIC
SH3	1021	1078	3.33e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000173006
AA Change: R524W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134147
Gene: ENSMUSG00000031442
AA Change: R524W

Domain	Start	End	E-Value	Type
Pfam:CRAL_TRIO_2	1	104	1.3e-12	PFAM
SPEC	233	334	4.41e-15	SMART
coiled coil region	386	408	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
RhoGEF	515	690	2.83e-63	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000173099
AA Change: R611W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442
AA Change: R611W

Domain	Start	End	E-Value	Type
SEC14	41	187	1.77e-24	SMART
SPEC	320	421	4.41e-15	SMART
coiled coil region	473	495	N/A	INTRINSIC
low complexity region	544	560	N/A	INTRINSIC
RhoGEF	602	777	2.83e-63	SMART
PH	797	914	8.13e-14	SMART
low complexity region	932	944	N/A	INTRINSIC
low complexity region	1014	1025	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	A	G	5: 121,626,080	S929P	probably damaging	Het
Ackr3	A	G	1: 90,214,841	T341A	probably benign	Het
Acox3	A	G	5: 35,603,033	Y431C	probably damaging	Het
Adamtsl2	G	A	2: 27,102,833	V653M	probably damaging	Het
Anks6	T	C	4: 47,045,007	K300E	probably damaging	Het
Ap5z1	A	T	5: 142,474,451	D495V	probably damaging	Het
Atm	A	T	9: 53,516,450	Y453*	probably null	Het
Atpaf2	A	T	11: 60,416,880	W11R	probably damaging	Het
Capn1	T	A	19: 6,013,660	T129S	probably benign	Het
Cdh17	A	G	4: 11,816,990	I800M	probably damaging	Het
Cfap206	C	T	4: 34,724,892	R69Q	probably damaging	Het
Cp	T	C	3: 19,978,877	Y623H	probably damaging	Het
Dcaf5	A	T	12: 80,340,201	Y384N	probably damaging	Het
Dhx9	A	T	1: 153,467,092	C555S	possibly damaging	Het
Dlg2	A	G	7: 91,968,180	T317A	probably benign	Het
Dsp	C	T	13: 38,192,652	T1471I	probably benign	Het
Ebf1	A	G	11: 44,992,401	M489V	possibly damaging	Het
Enpp3	T	C	10: 24,778,821	D230G	probably damaging	Het
Eri3	T	C	4: 117,649,356	M294T	possibly damaging	Het
Fat1	T	A	8: 45,039,836	V3842E	probably damaging	Het
Fermt1	T	A	2: 132,915,203	Y569F	possibly damaging	Het
Fscn1	A	G	5: 142,961,044	D199G	probably benign	Het
Glce	A	G	9: 62,070,203	V133A	probably benign	Het
Gm10020	T	C	15: 52,478,228		noncoding transcript	Het
Gm16432	A	T	1: 178,111,596	K678N	possibly damaging	Het
Gm5096	A	C	18: 87,757,268	Y305S	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Hk1	A	G	10: 62,286,441	S520P	probably benign	Het
Ighv12-3	A	G	12: 114,366,935	V7A	probably benign	Het
Ighv6-7	C	A	12: 114,455,856	A43S	probably damaging	Het
Inf2	A	G	12: 112,601,679	I222V	possibly damaging	Het
Kmo	T	A	1: 175,655,122	N337K	probably benign	Het
Mipep	A	T	14: 60,802,934	H301L	probably damaging	Het
Mprip	A	T	11: 59,760,963	E1831V	probably damaging	Het
Mrgpra3	T	C	7: 47,590,011	T56A	probably benign	Het
Mtmr14	G	A	6: 113,240,285	V53I	probably damaging	Het
Mycbp2	A	T	14: 103,135,243	W4056R	probably damaging	Het
Myl2	A	T	5: 122,106,720	D151V	possibly damaging	Het
Myo5c	A	T	9: 75,273,510	D727V	probably damaging	Het
Olfr381	A	T	11: 73,486,692	I44N	probably damaging	Het
Olfr466	A	G	13: 65,152,979	T252A	possibly damaging	Het
Olfr504	T	A	7: 108,565,565	M77L	probably benign	Het
Olfr693	A	T	7: 106,678,483	M1K	probably null	Het
Olfr982	A	G	9: 40,074,297	M1V	probably null	Het
Pabpc1l	C	T	2: 164,043,554	T409I	probably benign	Het
Pcgf1	C	T	6: 83,079,705	R81*	probably null	Het
Pcgf2	A	G	11: 97,692,367		probably null	Het
Phf14	T	A	6: 11,934,016	N292K	probably damaging	Het
Plin4	T	C	17: 56,102,147	T1358A	probably benign	Het
Pomgnt1	T	C	4: 116,155,967	S423P	probably damaging	Het
Pqlc3	T	A	12: 16,995,628	I114F	possibly damaging	Het
Prep	G	A	10: 45,097,437	V214I	probably benign	Het
Ptger1	T	C	8: 83,668,332		probably null	Het
Pus7	C	T	5: 23,748,834	G415D	probably benign	Het
Rbm44	C	T	1: 91,168,738	P940S	probably damaging	Het
Ripor1	A	T	8: 105,617,515	D427V	probably damaging	Het
Rp1	A	G	1: 4,345,237	I1884T	probably damaging	Het
Serinc2	T	C	4: 130,278,479	R7G	probably benign	Het
Serpina6	A	C	12: 103,654,460	F10C	possibly damaging	Het
Skint5	T	A	4: 113,688,706		probably null	Het
Slc6a4	A	T	11: 77,023,255	I544F	possibly damaging	Het
Spdye4b	T	C	5: 143,202,421	M223T	probably benign	Het
Tbc1d17	A	T	7: 44,848,331	V39D	probably damaging	Het
Thbs3	T	A	3: 89,219,463	Y295N	probably damaging	Het
Themis	G	A	10: 28,781,891	E152K	possibly damaging	Het
Tmem131	A	T	1: 36,799,338	I1502N	probably benign	Het
Tmem43	T	A	6: 91,477,354	M41K	probably benign	Het
Tmprss6	A	C	15: 78,440,303	W771G	probably damaging	Het
Trp53tg5	T	C	2: 164,471,336	T140A	probably benign	Het
Uchl1	A	G	5: 66,686,873	E206G	probably damaging	Het
Vash2	A	G	1: 190,960,291	V229A	possibly damaging	Het
Vmn1r192	C	A	13: 22,187,214	A279S	possibly damaging	Het
Vmn1r32	T	C	6: 66,553,172	R207G	probably damaging	Het
Vmn2r14	T	A	5: 109,220,395	M244L	probably benign	Het
Vwa5b2	T	A	16: 20,595,339	H236Q	probably damaging	Het
Zfp652	C	T	11: 95,749,290	P14S	probably benign	Het
Zfp668	G	A	7: 127,867,823	R194*	probably null	Het
Zgrf1	G	T	3: 127,561,025	V98L	probably benign	Het

Other mutations in Mcf2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Mcf2l	APN	8	13000857	missense	probably damaging	0.98
IGL00426:Mcf2l	APN	8	12984910	missense	probably damaging	1.00
IGL01391:Mcf2l	APN	8	13014010	splice site	probably null
IGL01795:Mcf2l	APN	8	13000749	splice site	probably null
IGL02314:Mcf2l	APN	8	13001851	missense	probably damaging	0.99
IGL02716:Mcf2l	APN	8	12997277	missense	probably benign	0.19
IGL02985:Mcf2l	APN	8	12963239	missense	probably damaging	1.00
IGL03073:Mcf2l	APN	8	13000004	missense	probably damaging	1.00
IGL03308:Mcf2l	APN	8	13009512	missense	probably damaging	1.00
IGL03371:Mcf2l	APN	8	13001298	missense	probably damaging	1.00
P0022:Mcf2l	UTSW	8	13018897	nonsense	probably null
R0062:Mcf2l	UTSW	8	13006766	unclassified	probably benign
R0067:Mcf2l	UTSW	8	13013060	missense	probably benign	0.01
R0110:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0450:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0469:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0510:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0543:Mcf2l	UTSW	8	12996728	critical splice donor site	probably null
R0591:Mcf2l	UTSW	8	13018751	missense	probably benign	0.11
R0801:Mcf2l	UTSW	8	13014020	intron	probably benign
R0962:Mcf2l	UTSW	8	13001964	missense	probably benign	0.14
R1084:Mcf2l	UTSW	8	13002645	missense	possibly damaging	0.94
R1794:Mcf2l	UTSW	8	12915982	missense	probably benign	0.33
R2111:Mcf2l	UTSW	8	13001867	missense	probably damaging	0.99
R2112:Mcf2l	UTSW	8	13001867	missense	probably damaging	0.99
R3785:Mcf2l	UTSW	8	12880099	missense	probably damaging	0.97
R4777:Mcf2l	UTSW	8	13018051	splice site	probably null
R4858:Mcf2l	UTSW	8	13013972	missense	probably damaging	1.00
R4980:Mcf2l	UTSW	8	12984883	missense	probably damaging	1.00
R5021:Mcf2l	UTSW	8	13011808	missense	probably damaging	1.00
R5067:Mcf2l	UTSW	8	12915959	intron	probably benign
R5158:Mcf2l	UTSW	8	13009715	missense	probably damaging	1.00
R5439:Mcf2l	UTSW	8	12926646	missense	possibly damaging	0.85
R5655:Mcf2l	UTSW	8	13010444	missense	probably damaging	0.98
R5668:Mcf2l	UTSW	8	13013812	nonsense	probably null
R5753:Mcf2l	UTSW	8	12999993	missense	probably damaging	1.00
R5808:Mcf2l	UTSW	8	12993937	start codon destroyed	probably null	0.92
R5946:Mcf2l	UTSW	8	13013922	missense	probably damaging	1.00
R6168:Mcf2l	UTSW	8	13001823	missense	probably benign	0.05
R6174:Mcf2l	UTSW	8	13013849	nonsense	probably null
R6212:Mcf2l	UTSW	8	13017431	missense	probably damaging	1.00
R6270:Mcf2l	UTSW	8	13018701	missense	probably damaging	0.99
R6383:Mcf2l	UTSW	8	12879912	start gained	probably benign
R6850:Mcf2l	UTSW	8	13009476	missense	possibly damaging	0.82
R6908:Mcf2l	UTSW	8	13018919	missense	probably benign
R7101:Mcf2l	UTSW	8	13013579	missense	possibly damaging	0.80
R7163:Mcf2l	UTSW	8	12915439	missense	probably benign	0.00
R7203:Mcf2l	UTSW	8	13010456	missense	probably benign	0.09
R7414:Mcf2l	UTSW	8	13019022	makesense	probably null
R7553:Mcf2l	UTSW	8	12997268	missense	probably benign
R7556:Mcf2l	UTSW	8	12973071	missense	probably damaging	0.99
R7688:Mcf2l	UTSW	8	12948130	missense	possibly damaging	0.74
R7776:Mcf2l	UTSW	8	12880127	missense	probably benign
R7947:Mcf2l	UTSW	8	13003529	splice site	probably null
R8077:Mcf2l	UTSW	8	12998494	critical splice donor site	probably null
R8083:Mcf2l	UTSW	8	13007875	splice site	probably null
R8133:Mcf2l	UTSW	8	13011487	missense	probably damaging	1.00
R8189:Mcf2l	UTSW	8	12963164	missense	probably damaging	0.98
R8453:Mcf2l	UTSW	8	12984956	splice site	probably null
R8520:Mcf2l	UTSW	8	12880089	missense	probably benign
R8865:Mcf2l	UTSW	8	12880003	missense	probably benign	0.00
R8895:Mcf2l	UTSW	8	12984330	intron	probably benign
R9081:Mcf2l	UTSW	8	13018697	missense	probably damaging	0.96
R9143:Mcf2l	UTSW	8	13012883	splice site	probably benign
R9219:Mcf2l	UTSW	8	13011383	missense	probably damaging	0.98
R9229:Mcf2l	UTSW	8	13013584	missense	probably benign	0.01
R9335:Mcf2l	UTSW	8	13000812	missense	possibly damaging	0.92
R9351:Mcf2l	UTSW	8	13000757	missense	possibly damaging	0.82
R9406:Mcf2l	UTSW	8	13009676	missense	probably damaging	1.00
R9442:Mcf2l	UTSW	8	12973048	missense	possibly damaging	0.91
R9618:Mcf2l	UTSW	8	12984320	intron	probably benign
X0052:Mcf2l	UTSW	8	13018713	missense	possibly damaging	0.89
Z1177:Mcf2l	UTSW	8	13009654	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCAATCCCAGAAGGCAGTGG -3'
(R):5'- AGCTAGGCAAGTCTCTTTTCAG -3'

Sequencing Primer
(F):5'- CCAGAAGGCAGTGGGAGCTG -3'
(R):5'- CAGGCAGGCTTTGAACCTATGATC -3'

Posted On

2016-10-24