Incidental Mutation 'R5569:Olfr381'
ID435551
Institutional Source Beutler Lab
Gene Symbol Olfr381
Ensembl Gene ENSMUSG00000072708
Gene Nameolfactory receptor 381
SynonymsGA_x6K02T2P1NL-3646409-3645474, MOR135-4
MMRRC Submission 043126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5569 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73484274-73491603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73486692 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 44 (I44N)
Ref Sequence ENSEMBL: ENSMUSP00000149355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078358] [ENSMUST00000119863] [ENSMUST00000214623] [ENSMUST00000215358]
Predicted Effect probably damaging
Transcript: ENSMUST00000078358
AA Change: I44N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077467
Gene: ENSMUSG00000072708
AA Change: I44N

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.3e-35 PFAM
Pfam:7tm_4 139 283 5.3e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119863
AA Change: I44N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113846
Gene: ENSMUSG00000072708
AA Change: I44N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-57 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206673
Predicted Effect probably damaging
Transcript: ENSMUST00000214623
AA Change: I44N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215358
AA Change: I44N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Ackr3 A G 1: 90,214,841 T341A probably benign Het
Acox3 A G 5: 35,603,033 Y431C probably damaging Het
Adamtsl2 G A 2: 27,102,833 V653M probably damaging Het
Anks6 T C 4: 47,045,007 K300E probably damaging Het
Ap5z1 A T 5: 142,474,451 D495V probably damaging Het
Atm A T 9: 53,516,450 Y453* probably null Het
Atpaf2 A T 11: 60,416,880 W11R probably damaging Het
Capn1 T A 19: 6,013,660 T129S probably benign Het
Cdh17 A G 4: 11,816,990 I800M probably damaging Het
Cfap206 C T 4: 34,724,892 R69Q probably damaging Het
Cp T C 3: 19,978,877 Y623H probably damaging Het
Dcaf5 A T 12: 80,340,201 Y384N probably damaging Het
Dhx9 A T 1: 153,467,092 C555S possibly damaging Het
Dlg2 A G 7: 91,968,180 T317A probably benign Het
Dsp C T 13: 38,192,652 T1471I probably benign Het
Ebf1 A G 11: 44,992,401 M489V possibly damaging Het
Enpp3 T C 10: 24,778,821 D230G probably damaging Het
Eri3 T C 4: 117,649,356 M294T possibly damaging Het
Fat1 T A 8: 45,039,836 V3842E probably damaging Het
Fermt1 T A 2: 132,915,203 Y569F possibly damaging Het
Fscn1 A G 5: 142,961,044 D199G probably benign Het
Glce A G 9: 62,070,203 V133A probably benign Het
Gm10020 T C 15: 52,478,228 noncoding transcript Het
Gm16432 A T 1: 178,111,596 K678N possibly damaging Het
Gm5096 A C 18: 87,757,268 Y305S probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hk1 A G 10: 62,286,441 S520P probably benign Het
Ighv12-3 A G 12: 114,366,935 V7A probably benign Het
Ighv6-7 C A 12: 114,455,856 A43S probably damaging Het
Inf2 A G 12: 112,601,679 I222V possibly damaging Het
Kmo T A 1: 175,655,122 N337K probably benign Het
Mcf2l C T 8: 13,005,481 R611W probably damaging Het
Mipep A T 14: 60,802,934 H301L probably damaging Het
Mprip A T 11: 59,760,963 E1831V probably damaging Het
Mrgpra3 T C 7: 47,590,011 T56A probably benign Het
Mtmr14 G A 6: 113,240,285 V53I probably damaging Het
Mycbp2 A T 14: 103,135,243 W4056R probably damaging Het
Myl2 A T 5: 122,106,720 D151V possibly damaging Het
Myo5c A T 9: 75,273,510 D727V probably damaging Het
Olfr466 A G 13: 65,152,979 T252A possibly damaging Het
Olfr504 T A 7: 108,565,565 M77L probably benign Het
Olfr693 A T 7: 106,678,483 M1K probably null Het
Olfr982 A G 9: 40,074,297 M1V probably null Het
Pabpc1l C T 2: 164,043,554 T409I probably benign Het
Pcgf1 C T 6: 83,079,705 R81* probably null Het
Pcgf2 A G 11: 97,692,367 probably null Het
Phf14 T A 6: 11,934,016 N292K probably damaging Het
Plin4 T C 17: 56,102,147 T1358A probably benign Het
Pomgnt1 T C 4: 116,155,967 S423P probably damaging Het
Pqlc3 T A 12: 16,995,628 I114F possibly damaging Het
Prep G A 10: 45,097,437 V214I probably benign Het
Ptger1 T C 8: 83,668,332 probably null Het
Pus7 C T 5: 23,748,834 G415D probably benign Het
Rbm44 C T 1: 91,168,738 P940S probably damaging Het
Ripor1 A T 8: 105,617,515 D427V probably damaging Het
Rp1 A G 1: 4,345,237 I1884T probably damaging Het
Serinc2 T C 4: 130,278,479 R7G probably benign Het
Serpina6 A C 12: 103,654,460 F10C possibly damaging Het
Skint5 T A 4: 113,688,706 probably null Het
Slc6a4 A T 11: 77,023,255 I544F possibly damaging Het
Spdye4b T C 5: 143,202,421 M223T probably benign Het
Tbc1d17 A T 7: 44,848,331 V39D probably damaging Het
Thbs3 T A 3: 89,219,463 Y295N probably damaging Het
Themis G A 10: 28,781,891 E152K possibly damaging Het
Tmem131 A T 1: 36,799,338 I1502N probably benign Het
Tmem43 T A 6: 91,477,354 M41K probably benign Het
Tmprss6 A C 15: 78,440,303 W771G probably damaging Het
Trp53tg5 T C 2: 164,471,336 T140A probably benign Het
Uchl1 A G 5: 66,686,873 E206G probably damaging Het
Vash2 A G 1: 190,960,291 V229A possibly damaging Het
Vmn1r192 C A 13: 22,187,214 A279S possibly damaging Het
Vmn1r32 T C 6: 66,553,172 R207G probably damaging Het
Vmn2r14 T A 5: 109,220,395 M244L probably benign Het
Vwa5b2 T A 16: 20,595,339 H236Q probably damaging Het
Zfp652 C T 11: 95,749,290 P14S probably benign Het
Zfp668 G A 7: 127,867,823 R194* probably null Het
Zgrf1 G T 3: 127,561,025 V98L probably benign Het
Other mutations in Olfr381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr381 APN 11 73486572 missense probably benign 0.22
IGL02867:Olfr381 APN 11 73485991 missense probably damaging 1.00
IGL03202:Olfr381 APN 11 73486525 nonsense probably null
R0207:Olfr381 UTSW 11 73486575 missense probably benign 0.00
R0539:Olfr381 UTSW 11 73486063 missense probably benign 0.22
R1469:Olfr381 UTSW 11 73486323 missense possibly damaging 0.81
R1469:Olfr381 UTSW 11 73486323 missense possibly damaging 0.81
R1835:Olfr381 UTSW 11 73486374 missense probably benign 0.08
R2095:Olfr381 UTSW 11 73486594 missense probably damaging 1.00
R3612:Olfr381 UTSW 11 73485940 missense probably benign 0.23
R3983:Olfr381 UTSW 11 73486135 missense possibly damaging 0.84
R4959:Olfr381 UTSW 11 73486067 nonsense probably null
R4983:Olfr381 UTSW 11 73486797 missense probably benign 0.04
R5297:Olfr381 UTSW 11 73486389 missense probably damaging 0.99
R5447:Olfr381 UTSW 11 73486176 missense probably benign 0.01
R5580:Olfr381 UTSW 11 73486210 missense probably benign
R5711:Olfr381 UTSW 11 73486182 missense probably damaging 1.00
R5810:Olfr381 UTSW 11 73486095 nonsense probably null
R6974:Olfr381 UTSW 11 73486473 missense probably benign 0.00
R7383:Olfr381 UTSW 11 73485889 makesense probably null
Predicted Primers PCR Primer
(F):5'- CATAGGCCATGATCACAAGGAG -3'
(R):5'- AGGATCTGACATTTTCCCATTAGG -3'

Sequencing Primer
(F):5'- TGGAAAAGTACATTTGTGTCAGGC -3'
(R):5'- GTACCAGCACCTGTTCTA -3'
Posted On2016-10-24