Incidental Mutation 'R5570:Phlpp1'
ID435584
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene NamePH domain and leucine rich repeat protein phosphatase 1
SynonymsPhlpp, Plekhe1
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106171752-106394250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106173432 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 477 (I477F)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
Predicted Effect probably benign
Transcript: ENSMUST00000061047
AA Change: I477F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: I477F

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190105
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106376255 missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106339448 missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106173436 missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106380389 missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106389883 missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106392714 missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106376297 splice site probably null
IGL03178:Phlpp1 APN 1 106392388 missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106392934 missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106339615 missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106350578 missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106392283 missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106389665 splice site probably null
R1394:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106380425 splice site probably null
R1438:Phlpp1 UTSW 1 106173412 missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106392319 missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106392789 missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106380385 missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106343505 missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106318850 missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106172839 missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106172772 missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106393191 small deletion probably benign
R3832:Phlpp1 UTSW 1 106392597 missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106392549 missense probably damaging 0.98
R4086:Phlpp1 UTSW 1 106347161 missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106364338 missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106386446 missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106339501 missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106389751 missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106281471 missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106173394 missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106172725 missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106364390 missense probably benign 0.02
R5590:Phlpp1 UTSW 1 106392927 missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106347132 nonsense probably null
R5955:Phlpp1 UTSW 1 106364230 splice site probably null
R5992:Phlpp1 UTSW 1 106318993 nonsense probably null
R6469:Phlpp1 UTSW 1 106287103 missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106386444 missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106172479 missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106172667 missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106389690 missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106392573 missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106281402 missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
R7957:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGACAGCACTGGCGTGATAG -3'
(R):5'- ACCTTGCAGATTTCAAGAATGC -3'

Sequencing Primer
(F):5'- TCGACTTCGGGGAGGATAC -3'
(R):5'- CTCAATTTAGTACTTGCACAGGCGG -3'
Posted On2016-10-24